Previous Contig 014048:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF047C14Sequence691014048 (2)gb:AY084716_15698029e-92Arabidopsis thaliana clone 115769 mRNA, complete sequence.802024246gb:AY084716_15698022e-74Arabidopsis thaliana clone 115769 mRNA, complete sequence.
JMSF053I07Sequence270008155 (2)873014048 (2)gb:AY084716_15698028e-66Arabidopsis thaliana clone 115769 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047C14+ GGTGAAGCATAAAGCCATGTTCAAGCTGAAAAC
                      ____________________________________________________________
consensus GGTGAAGCATAAAGCCATGTTCAAGCTGAAAAC
 
. : . : . : . : . : . :
JMSF047C14+ CCTAGTGAGAACTCACCACGGCGGGAAAGATGAGTCCTATAATTGTTGCATACAAAAGGA
                      ____________________________________________________________
consensus CCTAGTGAGAACTCACCACGGCGGGAAAGATGAGTCCTATAATTGTTGCATACAAAAGGA
 
. : . : . : . : . : . :
JMSF047C14+ GGATGAACTCGGGAAACTCGGGTTCCACCTCGGAAAAACCCTCCCAAAAGCCGCAACCAT
                      ____________________________________________________________
consensus GGATGAACTCGGGAAACTCGGGTTCCACCTCGGAAAAACCCTCCCAAAAGCCGCAACCAT
 
. : . : . : . : . : . :
JMSF047C14+ GGCGTTCTTCGACAACCTCAAAGAAATCGCGCCCAGAATCCTCCCCGTCCGGGAGCTTAT
                      ____________________________________________________________
consensus GGCGTTCTTCGACAACCTCAAAGAAATCGCGCCCAGAATCCTCCCCGTCCGGGAGCTTAT
 
. : . : . : . : . : . :
JMSF047C14+ CCGCTACGCCGCCCTCTCGTTCCTCCAAAAACTCCCGACAAACTCCGGAAAACCCGGAAC
                      ____________________________________________________________
consensus CCGCTACGCCGCCCTCTCGTTCCTCCAAAAACTCCCGACAAACTCCGGAAAACCCGGAAC
 
. : . : . : . : . : . :
JMSF047C14+ CACCTCAAAACCGGCGGCCATCAACTTCAAGACTGGAATCGATCACTTCTGCATCCACAC
rJMSF053I07+ CACTTCTGCCTGCACAC
                      ____________________________________________________________
consensus CACCTCAAAACCGGCGGCCATCAACTTCAAGACTGGAATCGATCACTTCTGCCTGCACAC
 
. : . : . : . : . : . :
JMSF047C14+ CGGCGGGAAAGCGGTGATCAACGGCATAGGGCAGAGCCTCAACCTGAGCGAATATGATTT
rJMSF053I07+ CGGCGGGAAGGCGGTGATCGACGGCATCGGGCAGAACCTGAACCTGAGCGAGTACGATCT
                      ____________________________________________________________
consensus CGGCGGGAAGGCGGTGATCGACGGCATCGGGCAGAGCCTGAACCTGAGCGAGTATGATTT
 
. : . : . : . : . : . :
JMSF047C14+ GGAGCCGGCGAGAATGACGCTGCACAGATTCGGGAACACGTCGGCCGGCAGCCTCTGGTA
rJMSF053I07+ GGAGCCGGCGAGAATGACGCTCCACCGGTTCGGCAACACCTCCGCCAGTAGCCTCTGGTA
                      ____________________________________________________________
consensus GGAGCCGGCGAGAATGACGCTGCACCGGTTCGGGAACACGTCGGCCGGTAGCCTCTGGTA
 
. : . : . : . : . : . :
JMSF047C14+ CGTGCTGGCCTACATGGAAGCTAAGAAGAGGCTTAAGAAAGGGGATAAGGTGTTCATGAT
rJMSF053I07+ CGTTCTGGGGTACATGGAGGCCAAGAAGCGGCTCAAGAAAGGCGACAAGGTGTTCATGAT
                      ____________________________________________________________
consensus CGTTCTGGGGTACATGGAGGCTAAGAAGCGGCTTAAGAAAGGGGATAAGGTGTTCATGAT
 
. : . : . : . : . : . :
JMSF047C14+ TAGCTTCGGGGCGGGGTTTAAGTGCAACAGTTGTGTGTGGGAAGTGGTTCGAGATTTG--
rJMSF053I07+ CAGCTTCGGGGCGGGGTTTAAGTGCAACAGTTGCCTGTGGGAGGTGGTTAGGGATTTGGG
                      ____________________________________________________________
consensus TAGCTTCGGGGCGGGGTTTAAGTGCAACAGTTGTGTGTGGGAGGTGGTTCGGGATTTGGG
 
. : . : . : . : . : . :
JMSF047C14+ -GAAGATGCAAATGTTTGGGAAGATTGCATTCATAGCTACCCACCACAAACCCTAATTAA
rJMSF053I07+ AGAAGAAGAAAATGTGTGGAAAGATGACATCCATAACTACCCTCCCCAAACCCTAACCAA
                      ____________________________________________________________
consensus AGAAGATGCAAATGTTTGGGAAGATTGCATTCATAGCTACCCTCCCCAAACCCTAATTAA
 
. : . : . : . : . : . :
JMSF047C14+ CCCTTTCTTGGACAAATATGGATGGCT
rJMSF053I07+ CCCTTTCTTGGACAAGTTTGGATGGCTCCAACATGAAGATCCAAACACCTTCAACATTCC
                      ____________________________________________________________
consensus CCCTTTCTTGGACAAGTTTGGATGGCTCCAACATGAAGATCCAAACACCTTCAACATTCC
 
. : . : . : . : . : . :
rJMSF053I07+ AGATGACTACGTCATCCCATGATGTTTTTCTTCCGGTAAAAAATGCACTTTTAGTCCCTC
                      ____________________________________________________________
consensus AGATGACTACGTCATCCCATGATGTTTTTCTTCCGGTAAAAAATGCACTTTTAGTCCCTC
 
. : . : . : . : . : . :
rJMSF053I07+ AATTTTACCCTCTTCTTAGAGATCTGAACAAATTTGATCACTACTCGAAATTATCTAAAT
                      ____________________________________________________________
consensus AATTTTACCCTCTTCTTAGAGATCTGAACAAATTTGATCACTACTCGAAATTATCTAAAT
 
. : . : . : . : . : . :
rJMSF053I07+ TGTTGTTAATTCAACCCTTCGATATAGTACCAACTTTCAAACTCTATTAGTACACACGTG
                      ____________________________________________________________
consensus TGTTGTTAATTCAACCCTTCGATATAGTACCAACTTTCAAACTCTATTAGTACACACGTG
 
. : . : . : . : . : . :
rJMSF053I07+ CCAGATTTGTTCGGATTATCTGGACTACTAGAGTACTAGTGAAGTTTGAGGGTAGTACTA
                      ____________________________________________________________
consensus CCAGATTTGTTCGGATTATCTGGACTACTAGAGTACTAGTGAAGTTTGAGGGTAGTACTA
 
. : . : . : . : . : . :
rJMSF053I07+ TATGACAAGGGACTCAATTCATAATACTTTAGACAATTGATGAGAGATCAAATTTATTTA
                      ____________________________________________________________
consensus TATGACAAGGGACTCAATTCATAATACTTTAGACAATTGATGAGAGATCAAATTTATTTA
 
. : . : . : . : . : . :
rJMSF053I07+ ATTAAATTGAAAGACTATAGTAACAATTATGTTTTTTTTTCCCTTTTTCTTCGTTAGGTT
                      ____________________________________________________________
consensus ATTAAATTGAAAGACTATAGTAACAATTATGTTTTTTTTTCCCTTTTTCTTCGTTAGGTT