Previous Contig 014045:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011B20Sequence470000578 (3)gb:AF480497_18037702e-35Oryza sativa clone BAC 24K23, complete sequence.575014045 (3)gb:AB005242_15095197e-40Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4.>gb:AY088511_15735
JMFF033L15Sequence571000578 (3)gb:AF480497_18037709e-51Oryza sativa clone BAC 24K23, complete sequence.699014045 (3)gb:AB005242_15095199e-58Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4.>gb:AY088511_15735
JMSF053G01Sequence691000578 (3)gb:AB005242_15095191e-71Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4.>gb:AY088511_15735858014045 (3)gb:AB005242_15095192e-43Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4.>gb:AY088511_15735

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF033L15+ AAAGGCAGA
                      ____________________________________________________________
consensus AAAGGCAGA
 
. : . : . : . : . : . :
rJMFF033L15+ GAAACCCCCCGATATGTGGATGCTGTTCTTACCGTCCCAGCTAGGGCCATGATGCCCATG
                      ____________________________________________________________
consensus GAAACCCCCCGATATGTGGATGCTGTTCTTACCGTCCCAGCTAGGGCCATGATGCCCATG
 
. : . : . : . : . : . :
rJMFF011B20+ TGCCATCTTTC
rJMFF033L15+ AGTGGAATCAACATAGCTTTTAACCGTGAGCTGGTTGGACCTGCCTTGCTGCCATCTTTC
rJMSF053G01+ TGCCATCTTTC
                      ____________________________________________________________
consensus AGTGGAATCAACATAGCTTTTAACCGTGAGCTGGTTGGACCTGCCTTGCTGCCATCTTTC
 
. : . : . : . : . : . :
rJMFF011B20+ AGGCTGTCAAATGAAGGGAAGTTGAGGGGGGAAACCGTGGAAGATATATGGAGCGGAATG
rJMFF033L15+ AGGCTGTCAAATGAAGGGAAGCTGAGGGGGGAAACCGTGGAAGATATATGGAGCGGAATG
rJMSF053G01+ AGGCTGTCAAATGAAGGGAAGCTGAGGTGGGAAACCGTGGAAGATATATGGAGCGGAATG
                      ____________________________________________________________
consensus AGGCTGTCAAATGAAGGGAAGCTGAGGGGGGAAACCGTGGAAGATATATGGAGCGGAATG
 
. : . : . : . : . : . :
rJMFF011B20+ TGCGCTAAGGTAGTCTGTGACCATCTAAGGCTCGGTGTGAAAACCGGGCTTCCATNCGTT
rJMFF033L15+ TGCGCTAAGGTAGTCTGTGACCATCTAAGGCTCGGTGTGAAAACCGGGCTTCCATACGTT
rJMSF053G01+ TGCGCTGAGGTAGTCTGTGACCATCTAAGGCTCGGTGTGAAAACCGGGCTTCCATACGTT
                      ____________________________________________________________
consensus TGCGCTAAGGTAGTCTGTGACCATCTAAGGCTCGGTGTGAAAACCGGGCTTCCATACGTT
 
. : . : . : . : . : . :
rJMFF011B20+ TGGAGGAAGGAAAGAGGCAGTGCCATTGACAGCTTGAAGAAAGAGTGGGAGGGAGTGAAG
rJMFF033L15+ TGGAGGAAGGAAAGAGGCAGTGCCATTGACAGCTTGAAGAAAGAGTGGGAGGGAGTGAAG
rJMSF053G01+ TGGAGGAAGGAAAGAGGCAGTGCCATTGACAGCTTGAAGAAAGAGTGGGAGGGAGTGAAG
                      ____________________________________________________________
consensus TGGAGGAAGGAAAGAGGCAGTGCCATTGACAGCTTGAAGAAAGAGTGGGAGGGAGTGAAG
 
. : . : . : . : . : . :
rJMFF011B20+ CTGATGGAGGAAGTGATTCCATTCTTCCAAACGGTGAGGCTGTCTCCACAAGCTGTAACA
rJMFF033L15+ CTGATGGAGGAAGTGATTCCATTCTTCCAAACGGTGAGGCTGTCTCCACAAGCTGTAACA
rJMSF053G01+ CTGATGGAGGAAGTGATTCCATTCTTCCAAACGGTGAGGCTGTCTCCACAAGCTGTAACA
                      ____________________________________________________________
consensus CTGATGGAGGAAGTGATTCCATTCTTCCAAACGGTGAGGCTGTCTCCACAAGCTGTAACA
 
. : . : . : . : . : . :
rJMFF011B20+ GTAGAAGATTGCGTGGTTGAAATCGCCGCAGCTGTGAAGCAGCAGTTGGGACAAAAAGAT
rJMFF033L15+ GTAGAAGATTGCGTGGTTGAAATCGCCGCAGCTGTGAAGCAGCAGTTGGGACAAAAAGAT
rJMSF053G01+ GTAGAAGATTGCGTGGTTGAAATCGCCGCAGCTGTGAAGCAGCAGTTGGGACAAAAAGAT
                      ____________________________________________________________
consensus GTAGAAGATTGCGTGGTTGAAATCGCCGCAGCTGTGAAGCAGCAGTTGGGACAAAAAGAT
 
. : . : . : . : . : . :
rJMFF011B20+ GCCGTGTTCAAACGTGCTGCTGATGCCATGATAGAATGGATCAAGCCCTGGAAGACCATT
rJMFF033L15+ GCCGTGTTCAAACGTGCTGCTGATGCCATGATAGAATGGATCAAGCCCTGGAAGACCATT
rJMSF053G01+ GCCGTGTTCAAACGTGCTGCTGATGCCATGATAGAATGGATCAAGCTCTGGAAGACCATT
                      ____________________________________________________________
consensus GCCGTGTTCAAACGTGCTGCTGATGCCATGATAGAATGGATCAAGCCCTGGAAGACCATT
 
. : . : . : . : . : . :
rJMFF011B20+ AAAGCTCAAAGAACTTAAAAGAGTTGTGTTAAGAGTCAAACAGTGGAAATAATTGTCTTT
rJMFF033L15+ AAAGCTCAAAGAACTTAAAAGAGTTGTGTTAAGAGTCAAACAGTGGAAATAATTGTCTTT
rJMSF053G01+ AAAGCTCAAAGAACTTAAAAGAGTTGTGTTAAGAGTCAAACAGTGGAAATAATTGTCTTT
                      ____________________________________________________________
consensus AAAGCTCAAAGAACTTAAAAGAGTTGTGTTAAGAGTCAAACAGTGGAAATAATTGTCTTT
 
. : . : . : . : . : . :
rJMFF011B20+ ACATAAAGAGAAACTTTGTCCTGTTCACAATTCTTTTGCAACAATAATTATTCTTGGACG
rJMFF033L15+ ACATAAAGAGAAACTTTGTCCTGTTCACAATTCTTTTGCAACAATAATTATTCTTGGACG
rJMSF053G01+ ACATAAAGAGAAACTTTGTCCTGTTCACAATTCTTTTGCAACAATAATTATTCTTGGACG
                      ____________________________________________________________
consensus ACATAAAGAGAAACTTTGTCCTGTTCACAATTCTTTTGCAACAATAATTATTCTTGGACG
 
. : . : . : . : . : . :
rJMFF011B20+ CTAACCACTTGAAAAGGCACAACTCTCTCACAGACAGAAAGATGGTTAAAGTTGCATACT
rJMFF033L15+ CTAACCACTTGAAAAGGCACAACTCTCTCACAGACAGAAAGATGGTTAAAGTTGCATACT
rJMSF053G01+ CTAACCACTTGAAAAGGCACAACTCTCTCACAGACAGAAAGATGGTTAAAGTTGCATACT
                      ____________________________________________________________
consensus CTAACCACTTGAAAAGGCACAACTCTCTCACAGACAGAAAGATGGTTAAAGTTGCATACT
 
. : . : . : . : . : . :
rJMFF011B20+ TCATGCAATTTCTACTCAAAATTA
rJMFF033L15+ TCATGCAATTTCTACTCAAAATTA
rJMSF053G01+ TCATGCAATTTCTACTCAAAATTACGGTGATTTTATCTTCAATGACAAGATTCCATGAAA
                      ____________________________________________________________
consensus TCATGCAATTTCTACTCAAAATTACGGTGATTTTATCTTCAATGACAAGATTCCATGAAA
 
. : . : . : . : . : . :
rJMSF053G01+ CTTCTGCGAGTGCATTTTACCTGCCCGCTGAAAGTGAACATGATTGACACTGCTTTCATT
                      ____________________________________________________________
consensus CTTCTGCGAGTGCATTTTACCTGCCCGCTGAAAGTGAACATGATTGACACTGCTTTCATT
 
. : . : . : . : . : . :
rJMSF053G01+ TTCAAAATCATGAATGACCAAAAAAACATTTTAAAGAGAACCGAGTGTTAGGACGACGTG
                      ____________________________________________________________
consensus TTCAAAATCATGAATGACCAAAAAAACATTTTAAAGAGAACCGAGTGTTAGGACGACGTG
 
. : . : . : . : . : . :
rJMSF053G01+ ATATTTTAGATTCAGTTTTAAGGCGTGATATTTTAGATGATTCTGATGATTCTGTCCTGA
                      ____________________________________________________________
consensus ATATTTTAGATTCAGTTTTAAGGCGTGATATTTTAGATGATTCTGATGATTCTGTCCTGA
 
. : . : . : . : . : . :
rJMSF053G01+ GCCGCTCCCGAGGAATATGTCTGTAGAAAGCTTTTACGGCTCCCATTGCACCATCCTCAT
                      ____________________________________________________________
consensus GCCGCTCCCGAGGAATATGTCTGTAGAAAGCTTTTACGGCTCCCATTGCACCATCCTCAT