Previous Contig 014040:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011N12Sequence581004428 (7)gb:BT002135_16357382e-13Arabidopsis thaliana putative cell division control protein (At3g01610) mRNA, co785014040 (4)gb:AP000616_18205181e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0514G12
JMSF002I24Sequence287004428 (7)gb:BT002135_16357380.004Arabidopsis thaliana putative cell division control protein (At3g01610) mRNA, co676014040 (4)gb:AP000616_18205185e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0514G12
JMSF040G06Sequence600004428 (7)gb:BT002135_16357382e-13Arabidopsis thaliana putative cell division control protein (At3g01610) mRNA, co908014040 (4)gb:AP000616_18205185e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0514G12
JMSF053A03Sequence664004428 (7)gb:BT002135_16357383e-13Arabidopsis thaliana putative cell division control protein (At3g01610) mRNA, co916014040 (4)gb:AP000616_18205184e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, clone:P0514G12

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040G06+ TGCGAGGACATGTTCACCATGCATAATTTCTTTGATGAG
                      ____________________________________________________________
consensus TGCGAGGACATGTTCACCATGCATAATTTCTTTGATGAG
 
. : . : . : . : . : . :
rJMSF040G06+ GTGGATGCTTTGACAACAGAGCGTAATAAAGAAGGGAGCTATGTTATAGAGCGGATGTTG
rJMSF053A03+ TATAGAGCGGATGTTG
                      ____________________________________________________________
consensus GTGGATGCTTTGACAACAGAGCGTAATAAAGAAGGGAGCTATGTTATAGAGCGGATGTTG
 
. : . : . : . : . : . :
rJMFF011N12+ TTGCTGATAGAATTAGATGGTGCAGANCAACGCAAGGACGTTTATGTTATTGGA
rJMSF040G06+ AACCAGTTGCTGATAGAATTAGATGGTGCAGAACAACGCAAGGACGTTTATGTTATTGGA
rJMSF053A03+ ANCCAGTTGCTGATAGAATTAGATGGTGCAGAACAACGCAAGGACGTTTATGTTATTGGA
                      ____________________________________________________________
consensus AACCAGTTGCTGATAGAATTAGATGGTGCAGAACAACGCAAGGACGTTTATGTTATTGGA
 
. : . : . : . : . : . :
rJMFF011N12+ GCAACAAATAGGCCAGAAGCAATGGACAGGGCTCTGTTACGACCTGGAAGGTTTGGAAAG
rJMSF040G06+ GCAACAAATAGGCCAGAAGCAATGGACAGGGCTCTGTTACGACCTGGAAGGTTTGGAAAG
rJMSF053A03+ GCAACAAATAGGCCAGAAGCAATGGACAGGGCTCTGTTACGACCTGGAAGGTTTGGAAAG
                      ____________________________________________________________
consensus GCAACAAATAGGCCAGAAGCAATGGACAGGGCTCTGTTACGACCTGGAAGGTTTGGAAAG
 
. : . : . : . : . : . :
rJMFF011N12+ CTCCTCTATGTCCCACTACCTAGTCCAGATGAACGTGGGCTTATCTTAAAAGCTCTTGCA
rJMSF040G06+ CTCCTCTATGTCCCACTACCTAGTCCAGATGAACGTGGGCTTATCTTAAAAGCTCTTGCA
rJMSF002I24+ ACTACCTAGTCCAGATGAACGTGGGCTTATCTTAAAAGCTCTTGCA
rJMSF053A03+ CTCCTCTATGTCCCACTACCTAGTCCAGATGAACGTGGGCTTATCTTAAAAGCTCTTGCA
                      ____________________________________________________________
consensus CTCCTCTATGTCCCACTACCTAGTCCAGATGAACGTGGGCTTATCTTAAAAGCTCTTGCA
 
. : . : . : . : . : . :
rJMFF011N12+ AGAAAAAAATCTATAGATCCCAGCGTAGACTTAGCAGCCTTAGGAAGACATGACTCTTGT
rJMSF040G06+ AGAAAAAAATCTATAGATCCCAGCGTAGACTTAGCAGCCTTAGGAAGACATGACTCTTGT
rJMSF002I24+ AGAAAAAAATCTATAGATCCCAGCATAGACTTAGCAGCCTTAGGAAGACATGACTCTTGT
rJMSF053A03+ AGAAAAAAATCTATAGATCCCAGCGTAGACTTAGCAGCCTTAGGAAGACATGACTCTTGT
                      ____________________________________________________________
consensus AGAAAAAAATCTATAGATCCCAGCGTAGACTTAGCAGCCTTAGGAAGACATGACTCTTGT
 
. : . : . : . : . : . :
rJMFF011N12+ AAAAATCTAAGTGGAGCTGACCTCTCAGCACTGATGCTTGAAGCTGCTATG---GCTGTT
rJMSF040G06+ AAAAATCTAAGTGGAGCTGACCTCTCAGCACTGATGCTTGAAGCTGCTATGGCCGCTGTT
rJMSF002I24+ AAAAATCTAAGTGGAGCTGACCTCTCAGCACTGATGCTTGAAGCTGCTATGGCCGCTGTT
rJMSF053A03+ AAAAATCTAAGTGGAGCTGACCTCTCAGCACTGATGCTTGAAGCTGCTATGGCCGCTGTT
                      ____________________________________________________________
consensus AAAAATCTAAGTGGAGCTGACCTCTCAGCACTGATGCTTGAAGCTGCTATGGCCGCTGTT
 
. : . : . : . : . : . :
rJMFF011N12+ GATGAGAAGTTGGAATCATCGTCATCAAATATGAGCGTATATGGCGTATCAACTACCATT
rJMSF040G06+ GATGAGAAGTTGGAATCATCGTCATCAAATATGAGCGTATATGGCGTATCAACTACCATT
rJMSF002I24+ GATGAGAAGTTGGAATCATCGTCATCAAATATGAGCGTATATGGCGTATCAACTACCATT
rJMSF053A03+ GATGAGAAGTTGGAATCATCGTCATCAAATATGAGCGTATATGGCGTATCAACTACCATT
                      ____________________________________________________________
consensus GATGAGAAGTTGGAATCATCGTCATCAAATATGAGCGTATATGGCGTATCAACTACCATT
 
. : . : . : . : . : . :
rJMFF011N12+ AAAGATGTGCATTTCGAATTGGCTCGGAAAAAAATTACTCCCTCGGTTTCTGTGGAGCAA
rJMSF040G06+ AAAGATGTGCATTTCGAATTGGCTCGGAAAAAAATTACTCCCTCGGTTTCTGTGGAGCAA
rJMSF002I24+ AAAGATGTGCATTTCGAATTGGCTCGGAAAAAAATTACTCCCTCGGTTTCTGTGGAGCAA
rJMSF053A03+ AAAGATGTGCATTTCGAATTGGCTCGGAAAAAAATTACTCCCTCGGTTTCTGTGGAGCAA
                      ____________________________________________________________
consensus AAAGATGTGCATTTCGAATTGGCTCGGAAAAAAATTACTCCCTCGGTTTCTGTGGAGCAA
 
. : . : . : . : . : . :
rJMFF011N12+ ATAGAATATTACAGAGTTTTGTCTCAAAACTTCAAAGCAGCATGAGAACAGACCTATATG
rJMSF040G06+ ATAGAATATTACAGAGTTTTGTCTCAAAACTTCAAAGCAGCATGAGAACAGACCTATATG
rJMSF002I24+ ATAGAATATTACAGAGTTTTGTCTCAAAACTTCAAAGCAGCATGAGAACAGACCTATATG
rJMSF053A03+ ATAGAATATTACAGAGTTTTGTCTCAAAACTTCAAAGCAGCATGAGAACAGACCTATATG
                      ____________________________________________________________
consensus ATAGAATATTACAGAGTTTTGTCTCAAAACTTCAAAGCAGCATGAGAACAGACCTATATG
 
. : . : . : . : . : . :
rJMFF011N12+ GTATGGATTTACACTTTGGAACTAAAGACTCGTTCTTGAGAATGAGTCGATATATCCCTC
rJMSF040G06+ GTATGGATTTACACTTTGGAACTAAAGACTCGTTCTTGAGAATGAGTCGATATATCCCTC
rJMSF002I24+ GTATGGATTTACACTTTGGAACTAAAGACTCGTTCTTGAGAATGAGTCGATATATCCCTC
rJMSF053A03+ GTATGGATTTACACTTTGGAACTAAAGACTCGTTCTTGAGAATGAGTCGATATATCCCTC
                      ____________________________________________________________
consensus GTATGGATTTACACTTTGGAACTAAAGACTCGTTCTTGAGAATGAGTCGATATATCCCTC
 
. : . : . : . : . : . :
rJMFF011N12+ TCGTCTAGTCATCTGGTTGTTTCATACACCCAAATGCTTTTTGGCCTTTAATAGATGTAC
rJMSF040G06+ TCGTCTAGTCATCTGGTTGTTTCATACACCCAAATGCTTTTTGGCCTTTAATAGATGTAC
rJMSF002I24+ TCGTCTAGTCATCTGGTTGTTTCATACACCCAAATGCTTTTTGGCCTTTAATAGATGTAC
rJMSF053A03+ TCGTCTAGTCATCTGGTTGTTTCATACACCCAAATGCTTTTTGGCCTTTAATAGATGTAC
                      ____________________________________________________________
consensus TCGTCTAGTCATCTGGTTGTTTCATACACCCAAATGCTTTTTGGCCTTTAATAGATGTAC
 
. : . : . : . : . : . :
rJMFF011N12+ AGATTATGATGCTACTGGTGTCCGGGACGAGAGAAATTTTGCAAATCTGGAGATTAATTT
rJMSF040G06+ AGATTATGATGCTACTGGTGTCCGGGACGAGAGAAATTTTGCAAATCTGGAGATTAATTT
rJMSF002I24+ AGATTATGATGCTACTGGTGTCCGGGACGAGAGAAATTTTGCAAATCTGGAGATTAATTT
rJMSF053A03+ AGATTATGATGCTACTGGTGTCCGGGACGAGAGAAATTTTGCAAATCTGGAGATTAATTT
                      ____________________________________________________________
consensus AGATTATGATGCTACTGGTGTCCGGGACGAGAGAAATTTTGCAAATCTGGAGATTAATTT
 
. : . : . : . : . : . :
rJMFF011N12+ TGTAGGCTCTTTTTAATGTTTATACCCCATCTGTGATGGGGAAGTTTTGAAGCTCCTAGG
rJMSF040G06+ TGTAGGCTCTTTTTAATGTTTATACCCCATCTGTGATGGGGAAGTTTTGAAGCTCCTAGG
rJMSF002I24+ TGTAGGCTCTTTTTAATGTTTATACCCCATCTGTGATGGGGAAGTTTTGAAGCTCCTAGG
rJMSF053A03+ TGTAGGCTCTTTTTAATGTTTATACCCCATCTGTGATGGGGAAGTTTTGAAGCTCCTAGG
                      ____________________________________________________________
consensus TGTAGGCTCTTTTTAATGTTTATACCCCATCTGTGATGGGGAAGTTTTGAAGCTCCTAGG
 
. : . : . : . : . : . :
rJMFF011N12+ GACTATATTCGGTTGAAGTTATTTTAAAAATGTTTGCTGTTATATGTACACTATTAAT
rJMSF040G06+ GACTATATTCGGTTGAAGTTATTTTAAAAATGTTTGCTGTTATATGTACACTATTAATTG
rJMSF002I24+ GACTATATTCGGTTGAAGTTATTTTAAAAATGTTTGCTGTTATATGTACACTATTAATTG
rJMSF053A03+ GACTATATTCGGTTGAAGTTATTTTAAAAATGTTTGCTGTTATATGTACACTATTAATTG
                      ____________________________________________________________
consensus GACTATATTCGGTTGAAGTTATTTTAAAAATGTTTGCTGTTATATGTACACTATTAATTG
 
. : . : . : . : . : . :
rJMSF040G06+ TTTTGTAAAAGGAAGATT
rJMSF002I24+ TTTTGTAAAAGGAAGATT
rJMSF053A03+ TTTTGTAAAAGGAAGATTTGGAATGGAAAAAGAAAAGAAGTTAGGTTTGTGCTTGGACAG
                      ____________________________________________________________
consensus TTTTGTAAAAGGAAGATTTGGAATGGAAAAAGAAAAGAAGTTAGGTTTGTGCTTGGACAG
 
. : . : . : . : . : . :
rJMSF053A03+ TTTTGACTTTTGAGATTTAAGTTTAATTTGTCAGATTGGGAAATTTTATGGTTTGTGAAT
                      ____________________________________________________________
consensus TTTTGACTTTTGAGATTTAAGTTTAATTTGTCAGATTGGGAAATTTTATGGTTTGTGAAT