Previous Contig 014038:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014L12Sequence566000754 (4)pir|T48486|T484863e-23hypothetical protein T28J14.90 - Arabidopsis thaliana>gb:ATT28J14_1555596 Arabid673014038 (2)gb:AY212968_15898363e-61Gossypium hirsutum ser-thr protein kinase mRNA, partial cds.
JMSF052P20Sequence660000754 (4)pir|T48486|T484864e-31hypothetical protein T28J14.90 - Arabidopsis thaliana>gb:ATT28J14_1555596 Arabid760014038 (2)gb:AY212968_15898362e-62Gossypium hirsutum ser-thr protein kinase mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF014L12+ ATTAAGGAATCAGAGCACTTGGATTGGTCAAT
rJMSF052P20+ ATCTGCATATTAAGGAATCAGAGCACTTGGATTGGTCAAT
                      ____________________________________________________________
consensus ATCTGCATATTAAGGAATCAGAGCACTTGGATTGGTCAAT
 
. : . : . : . : . : . :
rJMFF014L12+ GCGGTTGCGAATAGCCATGGGCATTGCTTACTGCCTCGAGTATATGTACCAGCTTAACCC
rJMSF052P20+ GCGGTTGCGAATAGCCATGGGCATTGCTTACTGCCTCGAGTATATGTACCAGCTTAACCC
                      ____________________________________________________________
consensus GCGGTTGCGAATAGCCATGGGCATTGCTTACTGCCTCGAGTATATGTACCAGCTTAACCC
 
. : . : . : . : . : . :
rJMFF014L12+ TCCCATACTTCACAGAAACCTGCAATCTTCTTCTGTTTACCTAACAGAAGACTATGCAGC
rJMSF052P20+ TCCCATACTTCACAGAAACCTGCAATCTTCTTCTGTTTACCTAACAGAAGACTATGCAGC
                      ____________________________________________________________
consensus TCCCATACTTCACAGAAACCTGCAATCTTCTTCTGTTTACCTAACAGAAGACTATGCAGC
 
. : . : . : . : . : . :
rJMFF014L12+ AAAGTTATCAGATTTCAACTTCTGGAATGAAGCAAAGAAAGGGGAATCAGATCTTCCATC
rJMSF052P20+ AAAGTTATCAGATTTCAACTTCTGGAATGAAGCAAAGAAAGGGGAATCAGATCTTCCATC
                      ____________________________________________________________
consensus AAAGTTATCAGATTTCAACTTCTGGAATGAAGCAAAGAAAGGGGAATCAGATCTTCCATC
 
. : . : . : . : . : . :
rJMFF014L12+ ACCTGATGAAGATGAAGATGAAGACTGCATTTTTAGCTTTGGGTTGATACTATTTGAGAT
rJMSF052P20+ ACCTGATGAAGATGAAGATGAAGACTGCATTTTTAGCTTTGGGTTGATACTATTTGAGAT
                      ____________________________________________________________
consensus ACCTGATGAAGATGAAGATGAAGACTGCATTTTTAGCTTTGGGTTGATACTATTTGAGAT
 
. : . : . : . : . : . :
rJMFF014L12+ GATTACTGGTAAGCTTCTTCCATATTCTGATGGGAATGGCTCCCTTGAAAACTGGGTAAC
rJMSF052P20+ GATTACTGGTAAGCTTCTTCCATATTCTGATGGGAATGGCTCCCTTGAAAACTGGGTAAC
                      ____________________________________________________________
consensus GATTACTGGTAAGCTTCTTCCATATTCTGATGGGAATGGCTCCCTTGAAAACTGGGTAAC
 
. : . : . : . : . : . :
rJMFF014L12+ AATCTGCTTGAAGGAAGAGAAGCCCCACACAGAAATGGTGGATCCTACACTGAAATCGTA
rJMSF052P20+ AATCTGCTTGAAGGAAGAGAAGCCCCACACAGAAATGGTGGATCCTACACTGAAATCGTA
                      ____________________________________________________________
consensus AATCTGCTTGAAGGAAGAGAAGCCCCACACAGAAATGGTGGATCCTACACTGAAATCGTA
 
. : . : . : . : . : . :
rJMFF014L12+ CGGGGAGAAAGAGCTCGAGAAACTGTTTGCTCTGATGAAAGATTGCATCCTCTCAGACCC
rJMSF052P20+ CGGGGAGAAAGAGCTCGAGAAACTGTTTGCTCTGATGAAAGATTGCATCCTCTCAGACCC
                      ____________________________________________________________
consensus CGGGGAGAAAGAGCTCGAGAAACTGTTTGCTCTGATGAAAGATTGCATCCTCTCAGACCC
 
. : . : . : . : . : . :
rJMFF014L12+ AACACAAAGACCAGGTGTGAAGGAGGTTGTTTCCAGGTTGAAGGAGATCACAGCTATGGG
rJMSF052P20+ AACACAAAGACCAGGTGTGGAGGAGGTTGTTTCCAGGTTGAAGGAGATCACAGCTATGGG
                      ____________________________________________________________
consensus AACACAAAGACCAGGTGTGGAGGAGGTTGTTTCCAGGTTGAAGGAGATCACAGCTATGGG
 
. : . : . : . : . : . :
rJMFF014L12+ TCCCGATGGTGCAATGCCAAAAACTTCGCCTCTTTGGTGGGCTGAGCTCGAGATTTTATC
rJMSF052P20+ TCCCGATGGTGCAATGCCAAAAACTTCGCCTCTTTGGTGGGCTGAGCTCGAGATTTTATC
                      ____________________________________________________________
consensus TCCCGATGGTGCAATGCCAAAAACTTCGCCTCTTTGGTGGGCTGAGCTCGAGATTTTATC
 
. : . : . : . : . : . :
rJMFF014L12+ CACAGATTCAATCTAAGACGGTTTAAATTACAGCAAAACTCACCTTAACCAATCTCCAGA
rJMSF052P20+ CACAGATTCAATCTAAGACGGTTTAAATTACAGCAAAACTCACCTTAACCAATCTCCAGA
                      ____________________________________________________________
consensus CACAGATTCAATCTAAGACGGTTTAAATTACAGCAAAACTCACCTTAACCAATCTCCAGA
 
. : . : . : . : . : . :
rJMFF014L12+ CGCATGTTGTCATTCTTATTGTTATTATTACTGTTACTATT
rJMSF052P20+ CGCATGTTGTCATTCTTATTGTTATTATTACTGTTACTATTATTTTTAACCTTTTGATTT
                      ____________________________________________________________
consensus CGCATGTTGTCATTCTTATTGTTATTATTACTGTTACTATTATTTTTAACCTTTTGATTT
 
. : . : . : . : . : . :
rJMSF052P20+ CCCTCCCCTGCCAACTTGACTCCATCAAGATTCAAGAATGGTGCTGATTGATTGATTCTT
                      ____________________________________________________________
consensus CCCTCCCCTGCCAACTTGACTCCATCAAGATTCAAGAATGGTGCTGATTGATTGATTCTT