Previous Contig 014037:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF052P18Sequence665014037 (2)gb:AY037193_15600876e-29Arabidopsis thaliana AT4g37280/C7A10_80 mRNA, complete cds.>gb:AY142038_1582875 871014037 (2)gb:AY037193_15600872e-51Arabidopsis thaliana AT4g37280/C7A10_80 mRNA, complete cds.>gb:AY142038_1582875

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052P18- GGCTAGTGGCCGTACGCCACCACTAGTATCCGCCGTTTCTCTCAATT
                      ____________________________________________________________
consensus GGCTAGTGGCCGTACGCCACCACTAGTATCCGCCGTTTCTCTCAATT
 
. : . : . : . : . : . :
JMSF052P18- GATAAGTTCAGGAGAGCGAAGTGCTTTGATCCTTTACCGATTGTTCCAGAAGAACCTTTT
                      ____________________________________________________________
consensus GATAAGTTCAGGAGAGCGAAGTGCTTTGATCCTTTACCGATTGTTCCAGAAGAACCTTTT
 
. : . : . : . : . : . :
JMSF052P18- TGAGACTCTTTAATTTCTTTTTTTCCATAAACAAAAATTCAACGAGAAGCTCGTAAAATG
                      ____________________________________________________________
consensus TGAGACTCTTTAATTTCTTTTTTTCCATAAACAAAAATTCAACGAGAAGCTCGTAAAATG
 
. : . : . : . : . : . :
JMSF052P18- GGGAACTTAAAGGCGATGGTTACGGACGATTCCGACACCGTTTCGGACGATGACGGCGCC
                      ____________________________________________________________
consensus GGGAACTTAAAGGCGATGGTTACGGACGATTCCGACACCGTTTCGGACGATGACGGCGCC
 
. : . : . : . : . : . :
JMSF052P18- ACCACTGTTACTGACTCGCCATCGTCATCGCCGCCTCCACATTCGTCATCCCTCTCCGGC
                      ____________________________________________________________
consensus ACCACTGTTACTGACTCGCCATCGTCATCGCCGCCTCCACATTCGTCATCCCTCTCCGGC
 
. : . : . : . : . : . :
JMSF052P18- CCCTTCGAAGAAGGAGAAGAAGTCCTTGCTTATCACAACCAATGTGTGTACAAAGCTAAG
                      ____________________________________________________________
consensus CCCTTCGAAGAAGGAGAAGAAGTCCTTGCTTATCACAACCAATGTGTGTACAAAGCTAAG
 
. : . : . : . : . : . :
JMSF052P18- ATTCAAAAGACTCGATTTGTGAAGGCAGAATGGGAGTATTTTGTTCACTATACCGGTTGG
                      ____________________________________________________________
consensus ATTCAAAAGACTCGATTTGTGAAGGCAGAATGGGAGTATTTTGTTCACTATACCGGTTGG
 
. : . : . : . : . : . :
JMSF052P18- AACAAAAACTGGGATGAATGGTTGGGCATAGATCGATTGATGAAAGTCACTGAAGAGAAC
                      ____________________________________________________________
consensus AACAAAAACTGGGATGAATGGTTGGGCATAGATCGATTGATGAAAGTCACTGAAGAGAAC
 
. : . : . : . : . : . :
JMSF052P18- TTACGAAAACAGCAGGAGCTTAATAATAAATATGACATGAAGAAGAACGAAAAGG-CCAG
rJMSF052P18+ ATATGACATGAAGAAGAACGAAAAGGNCCAG
                      ____________________________________________________________
consensus TTACGAAAACAGCAGGAGCTTAATAATAAATATGACATGAAGAAGAACGAAAAGGNCCAG
 
. : . : . : . : . : . :
JMSF052P18- GCGTGGATCACAATTAAAAGCAAAATGTTCTACTGGGACAAGAGCTAAAAGGCAAAAGAA
rJMSF052P18+ GCGTGGATCACAATTAAAAGCAAAATGTTCTACTGGGACAAGAGCTAAAAGGCAAAAGAA
                      ____________________________________________________________
consensus GCGTGGATCACAATTAAAAGCAAAATGTTCTACTGGGACAAGAGCTAAAAGGCAAAAGAA
 
. : . : . : . : . : . :
JMSF052P18- AGATGTTCAAAAGGACAAAGGTGTCCTACCTTCAGAGAAGCTTGGTTTTAACATTCAAAT
rJMSF052P18+ AGATGTTCAAAAGGACAAAGGTGTCCTACCTTCAGAGAAGCTTGGTTTTAACATTCAAAT
                      ____________________________________________________________
consensus AGATGTTCAAAAGGACAAAGGTGTCCTACCTTCAGAGAAGCTTGGTTTTAACATTCAAAT
 
. : . : . : . : . : . :
JMSF052P18- TCCATCCTCATTAAAGAAG
rJMSF052P18+ TCCATCCTCATTAAAGAAGCAGCTGGTTGATGATTGTGAATTTATTACCCATTTGGGCAA
                      ____________________________________________________________
consensus TCCATCCTCATTAAAGAAGCAGCTGGTTGATGATTGTGAATTTATTACCCATTTGGGCAA
 
. : . : . : . : . : . :
rJMSF052P18+ GCTTGTCCAACTTCCTCGTTCTCCGAGTGTAAATGAAATACTAAGCAAGTATAGTGACTA
                      ____________________________________________________________
consensus GCTTGTCCAACTTCCTCGTTCTCCGAGTGTAAATGAAATACTAAGCAAGTATAGTGACTA
 
. : . : . : . : . : . :
rJMSF052P18+ TCGCCTAAAAAAGGATGGAATAATTGCTGATTCAGTAAGCGAAATTCTTAGTGGATTGCA
                      ____________________________________________________________
consensus TCGCCTAAAAAAGGATGGAATAATTGCTGATTCAGTAAGCGAAATTCTTAGTGGATTGCA
 
. : . : . : . : . : . :
rJMSF052P18+ ATGTTACTTTGACAAAGCATTGTCTGCTATGCTCCTTTACAAGAATGAGCGCGAGCAATA
                      ____________________________________________________________
consensus ATGTTACTTTGACAAAGCATTGTCTGCTATGCTCCTTTACAAGAATGAGCGCGAGCAATA
 
. : . : . : . : . : . :
rJMSF052P18+ TCAAGAAGCAATTACAGATGGAGTCTTTCCTTCATCTGTGTATGGTGCTGAGCATCTATT
                      ____________________________________________________________
consensus TCAAGAAGCAATTACAGATGGAGTCTTTCCTTCATCTGTGTATGGTGCTGAGCATCTATT
 
. : . : . : . : . : . :
rJMSF052P18+ ACGTTTGTTTGTTAAATTTCCTGAAATATTGCACCATGCAAATATTGAGGATGAGACAGT
                      ____________________________________________________________
consensus ACGTTTGTTTGTTAAATTTCCTGAAATATTGCACCATGCAAATATTGAGGATGAGACAGT
 
. : . : . : . : . : . :
rJMSF052P18+ AACTGAGTTGCGACAGAAATTGCAGGACTTCCTCAGGTTCCTACAGAAGAATCAAAGCTC
                      ____________________________________________________________
consensus AACTGAGTTGCGACAGAAATTGCAGGACTTCCTCAGGTTCCTACAGAAGAATCAAAGCTC
 
. : . : . : . : . : . :
rJMSF052P18+ ATTTTTCCTATCATCATACATTGATCCAGAAGGTTCAGATGTTGTCAACAAGAAAGGAGA
                      ____________________________________________________________
consensus ATTTTTCCTATCATCATACATTGATCCAGAAGGTTCAGATGTTGTCAACAAGAAAGGAGA
 
. : . : . : . : . : . :
rJMSF052P18+ TGACTGAGCTCAAAACGTAGTGAAACTTATGCTCTGTATAAGTGCCTCCATCTTGCCCTC
                      ____________________________________________________________
consensus TGACTGAGCTCAAAACGTAGTGAAACTTATGCTCTGTATAAGTGCCTCCATCTTGCCCTC
 
. : . : . : . : . : . :
rJMSF052P18+ AAGCCCCCTCCCTCCACCCCATTTGTTCTAAGAAATTGGTTGGTTGCATTGTACATGTTG
                      ____________________________________________________________
consensus AAGCCCCCTCCCTCCACCCCATTTGTTCTAAGAAATTGGTTGGTTGCATTGTACATGTTG
 
. : . : . : . : . : . :
rJMSF052P18+ CTTTTGTCTGGTGAATAGCAACAGCAGGTGCTGTTATTTTGTAATGCTCGTTTTATACAG
                      ____________________________________________________________
consensus CTTTTGTCTGGTGAATAGCAACAGCAGGTGCTGTTATTTTGTAATGCTCGTTTTATACAG
 
. : . : . : . : . : . :
rJMSF052P18+ TTGAAACTCTGCACCTTCAAAAGGCTTCAATCCCAGGCTCCTTTTTTGCTGTTATTAATA
                      ____________________________________________________________
consensus TTGAAACTCTGCACCTTCAAAAGGCTTCAATCCCAGGCTCCTTTTTTGCTGTTATTAATA