Previous Contig 014036:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF052P15Sequence685014036 (2)710014036 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052P15- GACGGCGCCGAGATGAAACAGAAGCAGCATCGCCGAGAAAGTAGGCTCGC
rJMSF052P15+ GACGGCGCCGAGATGAAACAGAAGCAGCATCGCCGAGAAAGTAGGCTCGC
                      ____________________________________________________________
consensus GACGGCGCCGAGATGAAACAGAAGCAGCATCGCCGAGAAAGTAGGCTCGC
 
. : . : . : . : . : . :
JMSF052P15- CCGCTTCGCCGTCGTCCTCAATCGTGACGCCATCACCGCACCTGACTGCAACGTCAACCA
rJMSF052P15+ CCGCTTCGCCGTCGTCCTCAATCGTGACGCCATCACCGCACCTGACTGCAACGTCAACCA
                      ____________________________________________________________
consensus CCGCTTCGCCGTCGTCCTCAATCGTGACGCCATCACCGCACCTGACTGCAACGTCAACCA
 
. : . : . : . : . : . :
JMSF052P15- CCCTCAGCCGCGACCCAGCGCTGCCACCATCCACCGTCCGCCGTCATCGACGCCATCCTC
rJMSF052P15+ CCCTCAGCCGCGACCCAGCGCTGCCACCATCCACCGTCCGCCGTCATCGACGCCATCCTC
                      ____________________________________________________________
consensus CCCTCAGCCGCGACCCAGCGCTGCCACCATCCACCGTCCGCCGTCATCGACGCCATCCTC
 
. : . : . : . : . : . :
JMSF052P15- TGTCCCCGTCGCCCGCCATCGTCGACTGGAGCTTGATGAAGCAGGACGCGCTGGGAAGCC
rJMSF052P15+ TGTCCCCGTCGCCCGCCATCGTCGACTGGAGCTTGATGAAGCAGGACGCGCTGGGAAGCC
                      ____________________________________________________________
consensus TGTCCCCGTCGCCCGCCATCGTCGACTGGAGCTTGATGAAGCAGGACGCGCTGGGAAGCC
 
. : . : . : . : . : . :
JMSF052P15- CAGCCTCGCCCCACCGTCTCTTCTGGTCGCAACGACAGCATCGCCTGCGATTCCAAGTCG
rJMSF052P15+ CAGCCTCGCCCCACCGTCTCTTCTGGTCGCAACGACAGCATCGCCTGCGATTCCAAGTCG
                      ____________________________________________________________
consensus CAGCCTCGCCCCACCGTCTCTTCTGGTCGCAACGACAGCATCGCCTGCGATTCCAAGTCG
 
. : . : . : . : . : . :
JMSF052P15- CGCCGTCGTCGTCCTACGCCGCAACGCCTCGGATCCCTTTCGTCGTCGCCCGAAAGGTGA
rJMSF052P15+ CGCCGTCGTCGTCCTACGCCGCAACGCCTCGGATCCCTTTCGTCGTCGCCCGAAAGGTGA
                      ____________________________________________________________
consensus CGCCGTCGTCGTCCTACGCCGCAACGCCTCGGATCCCTTTCGTCGTCGCCCGAAAGGTGA
 
. : . : . : . : . : . :
JMSF052P15- GGACGAAACCTCGGCGTCTCACACAGCTGGTTGGAAGGTTGCAACGGCGAAAAAAAGACA
rJMSF052P15+ GGACGAAACCTCGGCGTCTCACACAGCTGGTTGGAAGGTTGCAACGGCGAAAAAAAGACA
                      ____________________________________________________________
consensus GGACGAAACCTCGGCGTCTCACACAGCTGGTTGGAAGGTTGCAACGGCGAAAAAAAGACA
 
. : . : . : . : . : . :
JMSF052P15- TCCGCAACCCATCTTCTCCCGCCTCACTGCGCCGTCAAATCGCCGATCGCAGTCATCCCA
rJMSF052P15+ TCCGCAACCCATCTTCTCCCGCCTCACTGCGCCGTCAAATCGCCGATCGCAGTCATCCCA
                      ____________________________________________________________
consensus TCCGCAACCCATCTTCTCCCGCCTCACTGCGCCGTCAAATCGCCGATCGCAGTCATCCCA
 
. : . : . : . : . : . :
JMSF052P15- CGATGCTCATAGCGGAAAACAAAAAAAGGACAACTCATCCACACAAGAACAAAAATATAA
rJMSF052P15+ CGATGCTCATAGCGGAAAACAAAAAAAGGACAACTCATCCACACAAGAACAAAAATATAA
                      ____________________________________________________________
consensus CGATGCTCATAGCGGAAAACAAAAAAAGGACAACTCATCCACACAAGAACAAAAATATAA
 
. : . : . : . : . : . :
JMSF052P15- ACAGGTATATTGATATTCAAAAACAAAAATACACAGAAATATATATTTTGGCTCCAAACA
rJMSF052P15+ ACAGGTATATTGATATTCAAAAACAAAAATACACAGAAATATATATTTTGGCTCCAAACA
                      ____________________________________________________________
consensus ACAGGTATATTGATATTCAAAAACAAAAATACACAGAAATATATATTTTGGCTCCAAACA
 
. : . : . : . : . : . :
JMSF052P15- TGCATAGTAATGTACTTACAAGGCAAAATCACTCTCAACAAACACACATTATGTATACGT
rJMSF052P15+ TGCATAGTAATGTACTTACAAGGCAAAATCACTCTCAACAAACACACATTATGTATACGT
                      ____________________________________________________________
consensus TGCATAGTAATGTACTTACAAGGCAAAATCACTCTCAACAAACACACATTATGTATACGT
 
. : . : . : . : . : . :
JMSF052P15- TTATGAACAGAGTAGCTTAATGTTTATAATTTCGA
rJMSF052P15+ TTATGAACAGAGTAGCTTAATGTTTATAATTTCGAAAAACAATTTATAACACTCAAATGA
                      ____________________________________________________________
consensus TTATGAACAGAGTAGCTTAATGTTTATAATTTCGAAAAACAATTTATAACACTCAAATGA