Previous Contig 014034:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF052O09Sequence650014034 (2)gb:AK117772_18157886e-76Arabidopsis thaliana At3g21360 mRNA for unknown protein, complete cds, clone: RA863014034 (2)gb:AK117772_1815788e-121Arabidopsis thaliana At3g21360 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052O09- GATGGCCTATATTCATAAATTTAGACTCCGATCATCTTCTTCAATTCTT
                      ____________________________________________________________
consensus GATGGCCTATATTCATAAATTTAGACTCCGATCATCTTCTTCAATTCTT
 
. : . : . : . : . : . :
JMSF052O09- CTATTCTAGAGAAGGAAAATACAGATTATTAGGTTCAAAATGCCGGAAAGTTTCTTCGCC
                      ____________________________________________________________
consensus CTATTCTAGAGAAGGAAAATACAGATTATTAGGTTCAAAATGCCGGAAAGTTTCTTCGCC
 
. : . : . : . : . : . :
JMSF052O09- CAATAAAATCCCGCAAAAGAAGCGATTTGACGGAAAACCCTTTCCGGCAGTGTTGTCGCC
                      ____________________________________________________________
consensus CAATAAAATCCCGCAAAAGAAGCGATTTGACGGAAAACCCTTTCCGGCAGTGTTGTCGCC
 
. : . : . : . : . : . :
JMSF052O09- GAACCCAAACGTGTCGTCTACTACAAGCTTCCCGGTTGCGATTAAGGAGCAAAAGCCATG
                      ____________________________________________________________
consensus GAACCCAAACGTGTCGTCTACTACAAGCTTCCCGGTTGCGATTAAGGAGCAAAAGCCATG
 
. : . : . : . : . : . :
JMSF052O09- GCTGGACGCTCTTCTTCATCAATCTGGGGCTATTCTCTTCAAAGGCTTTCCAGTCAACTC
                      ____________________________________________________________
consensus GCTGGACGCTCTTCTTCATCAATCTGGGGCTATTCTCTTCAAAGGCTTTCCAGTCAACTC
 
. : . : . : . : . : . :
JMSF052O09- GGCCTCTGACTTCAACGACGTCGTTGAGGCCTTCGGCTACGAGGAACTGCCCTACGTCGG
rJMSF052O09+ TACGAGGAACTGCCCTACGTCGG
                      ____________________________________________________________
consensus GGCCTCTGACTTCAACGACGTCGTTGAGGCCTTCGGCTACGAGGAACTGCCCTACGTCGG
 
. : . : . : . : . : . :
JMSF052O09- CGGCGCCGCCCCTCGGACCAACGTTGTCGGCCGTGTTTTCACTGCAAATGAATCCCCTCC
rJMSF052O09+ CGGCGCCGCCCCTCGGACCAACGTTGTCGGCCGTGTTTTCACTGCAAATGAATCCCCTCC
                      ____________________________________________________________
consensus CGGCGCCGCCCCTCGGACCAACGTTGTCGGCCGTGTTTTCACTGCAAATGAATCCCCTCC
 
. : . : . : . : . : . :
JMSF052O09- CGATCAGAAGATCCCTTTCCACCATGAAATGGCTCAGGTTCCAGAGTATCCATCAAAATT
rJMSF052O09+ CGATCAGAAGATCCCTTTCCACCATGAAATGGCTCAGGTTCCAGAGTATCCATCAAAATT
                      ____________________________________________________________
consensus CGATCAGAAGATCCCTTTCCACCATGAAATGGCTCAGGTTCCAGAGTATCCATCAAAATT
 
. : . : . : . : . : . :
JMSF052O09- GTTTTTTTACTGTGAAGTAGAACCTGGAAGTTCAGGGGAAACACCCATAGTTCTTAGTCA
rJMSF052O09+ GTTTTTTTACTGTGAAGTAGAACCTGGAAGTTCAGGGGAAACACCCATAGTTCTTAGTCA
                      ____________________________________________________________
consensus GTTTTTTTACTGTGAAGTAGAACCTGGAAGTTCAGGGGAAACACCCATAGTTCTTAGTCA
 
. : . : . : . : . : . :
JMSF052O09- TGTTGTGTATGAGAAGATGAAAAGCAAGTATCCCGAGTTCGTTGAAAGACTGGAGGAGCA
rJMSF052O09+ TGTTGTGTATGAGAAGATGAAAAGCAAGTATCCCGAGTTCGTTGAAAGACTGGAGGAGCA
                      ____________________________________________________________
consensus TGTTGTGTATGAGAAGATGAAAAGCAAGTATCCCGAGTTCGTTGAAAGACTGGAGGAGCA
 
. : . : . : . : . : . :
JMSF052O09- TGGGTTAATCTACATTAGGGTTTTGGGTGAAGAAGACAACCCTTTATCCCCCATCGGCCG
rJMSF052O09+ TGGGTTAATCTACATTAGGGTTTTGGGTGAAGAAGACAACCCTTTATCCCCCATCGGCCG
                      ____________________________________________________________
consensus TGGGTTAATCTACATTAGGGTTTTGGGTGAAGAAGACAACCCTTTATCCCCCATCGGCCG
 
. : . : . : . : . : . :
JMSF052O09- A
rJMSF052O09+ AGGTTGGAAGTCCACATTCTTGACCTCAGACAAGAGTGTTGCTGAGGAAAGGGCTGCGAA
                      ____________________________________________________________
consensus AGGTTGGAAGTCCACATTCTTGACCTCAGACAAGAGTGTTGCTGAGGAAAGGGCTGCGAA
 
. : . : . : . : . : . :
rJMSF052O09+ GTTGGGGATGAAGCTGGAATGGCTCGATGATGGTGGAGTGAAAACAGTTATGGGGCCAAT
                      ____________________________________________________________
consensus GTTGGGGATGAAGCTGGAATGGCTCGATGATGGTGGAGTGAAAACAGTTATGGGGCCAAT
 
. : . : . : . : . : . :
rJMSF052O09+ ACCGGCTATTAAGGTGGACAAAACTAGGCAGAGGAAGATATGGTTCAACAGCATGGTGGC
                      ____________________________________________________________
consensus ACCGGCTATTAAGGTGGACAAAACTAGGCAGAGGAAGATATGGTTCAACAGCATGGTGGC
 
. : . : . : . : . : . :
rJMSF052O09+ TGCATATACTGGCTGGGAAGATGCGCGAAACGACCCAAAGAAGGCAGTCACTTTCGGGGA
                      ____________________________________________________________
consensus TGCATATACTGGCTGGGAAGATGCGCGAAACGACCCAAAGAAGGCAGTCACTTTCGGGGA
 
. : . : . : . : . : . :
rJMSF052O09+ TGGAAAGCCTTTGCCTGCTGAAATCATACACGACTGCCTAGCCATCTTGGAAGAGGAAAG
                      ____________________________________________________________
consensus TGGAAAGCCTTTGCCTGCTGAAATCATACACGACTGCCTAGCCATCTTGGAAGAGGAAAG
 
. : . : . : . : . : . :
rJMSF052O09+ TGTTGCGGTTCCATGGAAGAAAGGCGATGTTCTGCTGATTGACAATATGGCAGTTCTTCA
                      ____________________________________________________________
consensus TGTTGCGGTTCCATGGAAGAAAGGCGATGTTCTGCTGATTGACAATATGGCAGTTCTTCA
 
. : . : . : . : . : . :
rJMSF052O09+ TGCTCGAAAACCATTCCTCCCTCCTCGTCGTGTTCTAGCCTCACTGTGCAAGTGATAGAA
                      ____________________________________________________________
consensus TGCTCGAAAACCATTCCTCCCTCCTCGTCGTGTTCTAGCCTCACTGTGCAAGTGATAGAA
 
. : . : . : . : . : . :
rJMSF052O09+ GCATTAGACACTGGGAATTTGCAATGTACAACATTGTTTGTATTACAAAGTGAGGCATGT
                      ____________________________________________________________
consensus GCATTAGACACTGGGAATTTGCAATGTACAACATTGTTTGTATTACAAAGTGAGGCATGT
 
. : . : . : . : . : . :
rJMSF052O09+ ATCTATATCAGGATAACATTATCAGTGCTTTTAGAAATGCAAGATACTTTGTATTGCTGC
                      ____________________________________________________________
consensus ATCTATATCAGGATAACATTATCAGTGCTTTTAGAAATGCAAGATACTTTGTATTGCTGC