Previous Contig 014030:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF032K23Sequence725007216 (4)gb:AE005173_8954813e-42Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC010793_153683014030 (3)gb:AY039869_15603838e-75Arabidopsis thaliana At1g79600/F20B17_3 mRNA, complete cds.
JMSF038G11Sequence655007216 (4)gb:AE005173_8954811e-27Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC010793_153862014030 (3)gb:AY039869_15603839e-75Arabidopsis thaliana At1g79600/F20B17_3 mRNA, complete cds.
JMSF052N09Sequence723007216 (4)gb:AE005173_8954813e-42Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC010793_153915014030 (3)gb:AC134346_1741756e-101Oryza sativa (japonica cultivar-group) chromosome 5 clone P0018A03, complete seq

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052N09+ ATGCATTAGACTTTTTG
                      ____________________________________________________________
consensus ATGCATTAGACTTTTTG
 
. : . : . : . : . : . :
rJMSF052N09+ TCCCCTGATGTAGATGTTTCTCCAATTGTACCAGCACTCCGAAATTTCTTTGACGATGCA
                      ____________________________________________________________
consensus TCCCCTGATGTAGATGTTTCTCCAATTGTACCAGCACTCCGAAATTTCTTTGACGATGCA
 
. : . : . : . : . : . :
rJMSF052N09+ CTTAACTCAACTGTGAGTGAACTTAACTTTAAGACAATTGTTGATGGCTTGGGTGCTGTG
                      ____________________________________________________________
consensus CTTAACTCAACTGTGAGTGAACTTAACTTTAAGACAATTGTTGATGGCTTGGGTGCTGTG
 
. : . : . : . : . : . :
rJMSF032K23+ CTAAGGTCCCTCACT
rJMSF038G11+ GTTCCAGCTTATTATGCATTGATTCTAAGGTCCCTCACT
rJMSF052N09+ TTGTATCAATACCCCTTTAATGTTCCAGCTTATTATGCATTGATTCTAAGGTCCCTCACT
                      ____________________________________________________________
consensus TTGTATCAATACCCCTTTAATGTTCCAGCTTATTATGCATTGATTCTAAGGTCCCTCACT
 
. : . : . : . : . : . :
rJMSF032K23+ GTTTTGGAAGGCTTAGCTCTATATGCTGATCCTAAGTTCAAAGTGCTAGCGGCATCATAT
rJMSF038G11+ GTTTTGGAAGGCTTAGCTCTATATGCTGATCCTAAGTTCAAAGTGCTAGCGGCATCATAT
rJMSF052N09+ GTTTTGGAAGGCTTAGCTCTATATGCTGATCCTAAGTTCAAAGTGCTAGCGGCATCATAT
                      ____________________________________________________________
consensus GTTTTGGAAGGCTTAGCTCTATATGCTGATCCTAAGTTCAAAGTGCTAGCGGCATCATAT
 
. : . : . : . : . : . :
rJMSF032K23+ CCATATTTTGCTAAGAGGCTTCTTACAGATCCGAACCCATATCTTAGAGATGCTCTCATT
rJMSF038G11+ CCATATTTTGCTAAGAGGCTTCTTACAGATCCGAACCCATATCTTAGAGATGCTCTCATT
rJMSF052N09+ CCATATTTTGCTAAGAGGCTTCTTACAGATCCGAACCCATATCTTAGAGATGCTCTCATT
                      ____________________________________________________________
consensus CCATATTTTGCTAAGAGGCTTCTTACAGATCCGAACCCATATCTTAGAGATGCTCTCATT
 
. : . : . : . : . : . :
rJMSF032K23+ GAGTTGCTTTTTAAGGATGGAAAGTTCAGGTGGAATAGACTTGAAAATCTGCTTGTCCAG
rJMSF038G11+ GAGTTGCTTTTTAAGGATGGAAAGTTCAGGTGGAATAGACTTGAAAATCTGCTTGTCCAG
rJMSF052N09+ GAGTTGCTTTTTAAGGATGGAAAGTTCAGGTGGAATAGACTTGAAAATCTGCTTGTCCAG
                      ____________________________________________________________
consensus GAGTTGCTTTTTAAGGATGGAAAGTTCAGGTGGAATAGACTTGAAAATCTGCTTGTCCAG
 
. : . : . : . : . : . :
rJMSF032K23+ GGAAAGAAAGATCGAGATTTTTCTGCAAGAGATGCCTTACAACCTGTCCTAAAGTTATTA
rJMSF038G11+ GGAAAGAAAGATCGAGATTTTTCTGCAAGAGATGCCTTACAACCTGTCCTAAAGTTATTA
rJMSF052N09+ GGAAAGAAAGATCGAGATTTTTCTGCAAGAGATGCCTTACAACCTGTCCTAAAGTTATTA
                      ____________________________________________________________
consensus GGAAAGAAAGATCGAGATTTTTCTGCAAGAGATGCCTTACAACCTGTCCTAAAGTTATTA
 
. : . : . : . : . : . :
rJMSF032K23+ TTGGGTCCAGACGGTGAGGAATTGAGGGTTTTGGTGACTAAAGAGGCTATTCGTGTCACT
rJMSF038G11+ TTGGGTCCAGACGGTGAGGAATTGAGGGTTTTGGTGACTAAAGAGGCTATTCGTGTCACT
rJMSF052N09+ TTGGGTCCAGACGGTGAGGAATTGAGGGTTTTGGTGACTAAAGAGGCTATTCGTGTCACT
                      ____________________________________________________________
consensus TTGGGTCCAGACGGTGAGGAATTGAGGGTTTTGGTGACTAAAGAGGCTATTCGTGTCACT
 
. : . : . : . : . : . :
rJMSF032K23+ GAAGCTGTCATTCTGGGCTCAATTATTGAATCATATAACTTCATCCCTGGTCCGATGAGG
rJMSF038G11+ GAAGCTGTCATTCTGGGCTCAATTATTGAATCATATAACTTCATCCCTGGTCCGATGAGG
rJMSF052N09+ GAAGCTGTCATTCTGGGCTCAATTATTGAATCATATAACTTCATCCCTGGTCCGATGAGG
                      ____________________________________________________________
consensus GAAGCTGTCATTCTGGGCTCAATTATTGAATCATATAACTTCATCCCTGGTCCGATGAGG
 
. : . : . : . : . : . :
rJMSF032K23+ ACTATTATCTTCAATGGCAATGCAGCCGGTCCTCTTGTGATGAATCCTGCTGAACAGGAA
rJMSF038G11+ ACTATTATCTTCAATGGCAATGCAGCCGGTCCTCTTGTGATGAATCCTGCTGAACAGGAA
rJMSF052N09+ ACTATTATCTTCAATGGCAATGCAGCCGGTCCTCTTGTGATGAATCCTGC--AACAGGAA
                      ____________________________________________________________
consensus ACTATTATCTTCAATGGCAATGCAGCCGGTCCTCTTGTGATGAATCCTGCTGAACAGGAA
 
. : . : . : . : . : . :
rJMSF032K23+ AGCATGATGGATCTCAGGGCACAAGTATTTAGGATATGGGGTCTTTTGCGATCCTCTGAG
rJMSF038G11+ AGCATGATGGATCTCAGGGCACAAGTATTTAGGATATGGGGTCTTTTGCGATCCTCTGAG
rJMSF052N09+ AGCATGATGGATCTCAGGGCACAAGTATTTAGGATATGGGGTCTTTTGCGATCCTCTGAG
                      ____________________________________________________________
consensus AGCATGATGGATCTCAGGGCACAAGTATTTAGGATATGGGGTCTTTTGCGATCCTCTGAG
 
. : . : . : . : . : . :
rJMSF032K23+ AGTTTTGACCCAAGCCTTCTACAACCTATTTTACAG
rJMSF038G11+ AGTTTTGACCCAAGCCTTCTACAACCTATTTTACAG
rJMSF052N09+ AGTTTTGACCCAAGCCTTCTACAACCTATTTTACAGATACTCCAAGAACCTGAGGCACGC
                      ____________________________________________________________
consensus AGTTTTGACCCAAGCCTTCTACAACCTATTTTACAGATACTCCAAGAACCTGAGGCACGC
 
. : . : . : . : . : . :
rJMSF052N09+ AGCATTGGAGGACGCGTTGTTGGTGGAATAAGCCAACGCCTTGCAGCGCGGTTACTGCAA
                      ____________________________________________________________
consensus AGCATTGGAGGACGCGTTGTTGGTGGAATAAGCCAACGCCTTGCAGCGCGGTTACTGCAA
 
. : . : . : . : . : . :
rJMSF052N09+ CAAGTTCTTCGAGCTCCTTCTCCAACTGTTAAGTAATTGTATCTCAAAATTCCTGTTGTA
                      ____________________________________________________________
consensus CAAGTTCTTCGAGCTCCTTCTCCAACTGTTAAGTAATTGTATCTCAAAATTCCTGTTGTA
 
. : . : . : . : . : . :
rJMSF052N09+ GATTCAAAGGAAAACTGAAATTCTGTCACCATGACCTGTGACAATTATGTTCGAATGCTT
                      ____________________________________________________________
consensus GATTCAAAGGAAAACTGAAATTCTGTCACCATGACCTGTGACAATTATGTTCGAATGCTT