Previous Contig 014026:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019H02Sequence254005825 (2)716014026 (2)gb:BT000792_16350631e-74Arabidopsis thaliana clone RAFL05-20-J01 (R10342) unknown protein (At2g41190) mR
JMSF052M06Sequence646005825 (2)gb:AC004261_15316194e-30Arabidopsis thaliana chromosome 2 clone T3K9 map CIC11C08, complete sequence.>gb925014026 (2)gb:BT000792_16350635e-82Arabidopsis thaliana clone RAFL05-20-J01 (R10342) unknown protein (At2g41190) mR

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052M06+ TTCAGCATGTGGAGTTGTTGCAACT
                      ____________________________________________________________
consensus TTCAGCATGTGGAGTTGTTGCAACT
 
. : . : . : . : . : . :
rJMSF052M06+ ATAGTCATTGTGGNTTTCTGTAGCTTTACTCACTATAGTAGATGGAGTTGGATCACCCCA
                      ____________________________________________________________
consensus ATAGTCATTGTGGNTTTCTGTAGCTTTACTCACTATAGTAGATGGAGTTGGATCACCCCA
 
. : . : . : . : . : . :
rJMSF019H02+ ATTGGAGTGGTATTCC-TTTTCCATTGGTGTATATGGATTTTG
rJMSF052M06+ GACAGGTCAATTGGTAAATTGGAGTGGTATTCCTTTTTCCATTGGTGTATATGGATTTTG
                      ____________________________________________________________
consensus GACAGGTCAATTGGTAAATTGGAGTGGTATTCCTTTTTCCATTGGTGTATATGGATTTTG
 
. : . : . : . : . : . :
rJMSF019H02+ TTATGCTGGCCACTCTGTCTTTCCCAATATTTACCAATCAATGGCTGATAAAAAGAAATT
rJMSF052M06+ TTATGCTGGCCACTCTGTCTTTCCCAATATTTACCAATCAATGGCTGATAAAAAGAAATT
                      ____________________________________________________________
consensus TTATGCTGGCCACTCTGTCTTTCCCAATATTTACCAATCAATGGCTGATAAAAAGAAATT
 
. : . : . : . : . : . :
rJMSF019H02+ TACAAAGGCAATGACTATATGCTTTATTTTGTGTGTTGCAATGTATGGGAGTGTTGCAGT
rJMSF052M06+ TACAAAGGCAATGACTATATGCTTTATTTTGTGTGTTGCAATGTATGGGAGTGTTGCAGT
                      ____________________________________________________________
consensus TACAAAGGCAATGACTATATGCTTTATTTTGTGTGTTGCAATGTATGGGAGTGTTGCAGT
 
. : . : . : . : . : . :
rJMSF019H02+ TATGGGATATCTCCTGTTTGGTGATAATACATTGTCTCAGATCACTCTAAACATGCCACG
rJMSF052M06+ TATGGGATATCTCCTGTTTGGTGATAATACATTGTCTCAGATCACTCTAAACATGCCACG
                      ____________________________________________________________
consensus TATGGGATATCTCCTGTTTGGTGATAATACATTGTCTCAGATCACTCTAAACATGCCACG
 
. : . : . : . : . : . :
rJMSF019H02+ TGATTCTATTGCTTCAAAAATTGCAGTGTGGACAACAGTTATCAACCCTTTCACAAAATA
rJMSF052M06+ TGATTCTATTGCTTCAAAAATTGCAGTGTGGACAACAGTTATCAACCCTTTCACAAAATA
                      ____________________________________________________________
consensus TGATTCTATTGCTTCAAAAATTGCAGTGTGGACAACAGTTATCAACCCTTTCACAAAATA
 
. : . : . : . : . : . :
rJMSF019H02+ TGCCCTGATGATAAATCCACTGGCTAGAGCCGTGGAGGAGTTGCTGCCTGAGAGAATCTC
rJMSF052M06+ TGCCCTGATGATAAATCCACTGGCTAGAGCCGTGGAGGAGTTGCTGCCTGAGAGAATCTC
                      ____________________________________________________________
consensus TGCCCTGATGATAAATCCACTGGCTAGAGCCGTGGAGGAGTTGCTGCCTGAGAGAATCTC
 
. : . : . : . : . : . :
rJMSF019H02+ CAGTAGTTTCTGGTGTTTTGTTCTGCTAAGGACAGCACTTGTAGCTTCAACCGTTTGTGT
rJMSF052M06+ CAGTAGTTTCTGGTGTTTTGTTCTGCTAAGGACAGCACTTGTAGCTTCAACCGTTTGTGT
                      ____________________________________________________________
consensus CAGTAGTTTCTGGTGTTTTGTTCTGCTAAGGACAGCACTTGTAGCTTCAACCGTTTGTGT
 
. : . : . : . : . : . :
rJMSF019H02+ CGCATTCCTTCTTCCTTTCTTCGGCCTTGTGATGGCTTTAATCGGGTCTCTCCTCAGTAT
rJMSF052M06+ CGCATTCCTTCTTCCTTTCTTCGGCCTTGTGATGGCTTTAATCGGGTCTCTCCTCAGTAT
                      ____________________________________________________________
consensus CGCATTCCTTCTTCCTTTCTTCGGCCTTGTGATGGCTTTAATCGGGTCTCTCCTCAGTAT
 
. : . : . : . : . : . :
rJMSF019H02+ ACTACTGGCGGTTATTATGCCAACATTGTGTTTTCTGAAGATCCTGGATAAGAAAGTGAC
rJMSF052M06+ ACTACTGGCGGTTATTATGCCAACATTGTGTTTTCTGAAGATCCTGGATAAGAAAGTGAC
                      ____________________________________________________________
consensus ACTACTGGCGGTTATTATGCCAACATTGTGTTTTCTGAAGATCCTGGATAAGAAAGTGAC
 
. : . : . : . : . : . :
rJMSF019H02+ AACCGTACAGAGGGCTGCTAGCATCACTGTTGTGGTTTTGGGTATCATAAGTGCAGCTCT
rJMSF052M06+ AACCGTACAGAGGGCTGCTAGCATCACTGTTGTGGTTTTGGGTATCATAAGTGCAGCTCT
                      ____________________________________________________________
consensus AACCGTACAGAGGGCTGCTAGCATCACTGTTGTGGTTTTGGGTATCATAAGTGCAGCTCT
 
. : . : . : . : . : . :
rJMSF019H02+ GGGGACATACTCTTCAGTATCGAAAATCGCAAAGCAATACTGAAAGCCAGGACAAAGAAC
rJMSF052M06+ GGGGACATACTCTTCAGTATCGAAAATCGCAAAGCAATACTGAAAGCCAGGACAAAGAAC
                      ____________________________________________________________
consensus GGGGACATACTCTTCAGTATCGAAAATCGCAAAGCAATACTGAAAGCCAGGACAAAGAAC
 
. : . : . : . : . : . :
rJMSF019H02+ AATTTCTTCTGCTCTCTTCAGTGTTTTAGCTGATATTGACGTTTTCTGTTTTTCCTAGAA
rJMSF052M06+ AATTTCTTCTGCTCTCTTCAGTGTTTTAGCTGATATTGACGTTTTCTGTTTTTCCTAGAA
                      ____________________________________________________________
consensus AATTTCTTCTGCTCTCTTCAGTGTTTTAGCTGATATTGACGTTTTCTGTTTTTCCTAGAA
 
. : . : . : . : . : . :
rJMSF019H02+ TAACTGTCATCGAC
rJMSF052M06+ TAACTGTCATCGACTGTCTTAGCGTACGTGAACGGTATGAAGGACAAAATTATTCTTGCT
                      ____________________________________________________________
consensus TAACTGTCATCGACTGTCTTAGCGTACGTGAACGGTATGAAGGACAAAATTATTCTTGCT
 
. : . : . : . : . : . :
rJMSF052M06+ TTTGCTTGAGCAGATGGTTACTACTTTCTATTGTTGTTGTAGTAGTAGTAGTGCTACTAC
                      ____________________________________________________________
consensus TTTGCTTGAGCAGATGGTTACTACTTTCTATTGTTGTTGTAGTAGTAGTAGTGCTACTAC