Previous Contig 014023:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017C03Sequence320019011gb:AP004326_18402200.004Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ12724014023 (2)pir|T02323|T023234e-43nodulin-like protein [imported] - Arabidopsis thaliana>gb:AC004481_1531736 Arabi
JMSF052L12Sequence561014023 (2)pir|T02323|T023232e-26nodulin-like protein [imported] - Arabidopsis thaliana>gb:AC004481_1531736 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF017C03+ TTTGATCAATTAGACGATGAGCCA
                      ____________________________________________________________
consensus TTTGATCAATTAGACGATGAGCCA
 
. : . : . : . : . : . :
rJMSF017C03+ CTCGACTTACTTGACCAACAGAAGACGAGGTTAGCTCTTAGATCCTCTGGAAATAACAAG
                      ____________________________________________________________
consensus CTCGACTTACTTGACCAACAGAAGACGAGGTTAGCTCTTAGATCCTCTGGAAATAACAAG
 
. : . : . : . : . : . :
rJMSF017C03+ CGCAAGGCAGAATCTGACGATGAGATGGAGATAGATGCCGAGGGGCATCTTATCATTCGT
                      ____________________________________________________________
consensus CGCAAGGCAGAATCTGACGATGAGATGGAGATAGATGCCGAGGGGCATCTTATCATTCGT
 
. : . : . : . : . : . :
rJMSF017C03+ GAGGAAGACGGGAAGCCAAAAAGAAAGAAGTCACTCGACAGCGAGGCAGATGTAAGAAGT
rJMSF052L12+ AGCGAGGCAGATGTAAGAAGT
                      ____________________________________________________________
consensus GAGGAAGACGGGAAGCCAAAAAGAAAGAAGTCACTCGACAGCGAGGCAGATGTAAGAAGT
 
. : . : . : . : . : . :
rJMSF017C03+ GAAACTGGCAGTCGCTCGTCAATGAACTCAAGAAAAACCCAAACCCAAACCCAGAAACGC
rJMSF052L12+ GAAACTGGCAGTCNCTCGTCAATGANCTCAAGAAAAANCCAANCCCNNACCCAGAAACGC
                      ____________________________________________________________
consensus GAAACTGGCAGTCGCTCGTCAATGAACTCAAGAAAAACCCAAACCCAAACCCAGAAACGC
 
. : . : . : . : . : . :
rJMSF017C03+ AGGAAAACATCAGATGCTGGATGGGCTTACACAGGAAACGAATACTCAAGCAAGAAAGCA
rJMSF052L12+ AGGAAAACATCAGATGCTGGATGGGCTTACACANGAANCGAATACTCAAGCAAGAAAGCA
                      ____________________________________________________________
consensus AGGAAAACATCAGATGCTGGATGGGCTTACACAGGAAACGAATACTCAAGCAAGAAAGCA
 
. : . : . : . : . : . :
rJMSF017C03+ AGTGGCGACGTGAAGCGCAAGGGCAAACTCGAGCCATATGCCTACTGGCCCCTTGACCGC
rJMSF052L12+ AGTGGCGACGTGAAGCGCAAGGGCAAACTCGAGCCATATGCCTANTGGCCCCTTGGCCGC
                      ____________________________________________________________
consensus AGTGGCGACGTGAAGCGCAAGGGCAAACTCGAGCCATATGCCTACTGGCCCCTTGGCCGC
 
. : . : . : . : . : . :
rJMSF017C03+ AAGATGATGAGCCGCAGGCCGGAACAACGCGCTGCTGCAAGAAAAGGCATGTCGAGTGTG
rJMSF052L12+ AAGATGATGANCNGCAGGCCGGAACAACGCGCTGCTGCAAGAAAAGGCATGTCGAGTGTG
                      ____________________________________________________________
consensus AAGATGATGAGCCGCAGGCCGGAACAACGCGCTGCTGCAAGAAAAGGCATGTCGAGTGTG
 
. : . : . : . : . : . :
rJMSF017C03+ GTGAAGATGACGAAGAAGTTGGAGGGGAAGAGTGTTGCTAACGCCCTTAAAATGAAAGGA
rJMSF052L12+ GTGAAGATGACGAAGAAGTTGGAGGGGAAGAGTGTTGCTANCNCCCTTAAAATGAAAGGA
                      ____________________________________________________________
consensus GTGAAGATGACGAAGAAGTTGGAGGGGAAGAGTGTTGCTAACGCCCTTAAAATGAAAGGA
 
. : . : . : . : . : . :
rJMSF017C03+ GCAAAAGGGAGCAAGAAGAGGGGCACAAGCAAAAGTTAGATGAAGTAGATGCTGGTCCAA
rJMSF052L12+ GCAAAAGGGAGCAAGAAGAGGGGCNCAAGCAANAGTTAGATGAAGTAGATGNTGGTCCAA
                      ____________________________________________________________
consensus GCAAAAGGGAGCAAGAAGAGGGGCACAAGCAAAAGTTAGATGAAGTAGATGCTGGTCCAA
 
. : . : . : . : . : . :
rJMSF017C03+ GTATGAAGTTGAAGTTGGGCTGTTAGTTGCTAATTATACTTTGCCTCCATCAAGGTCATT
rJMSF052L12+ GTATGAAGTTGAAGTTNGGCTGTTTGTTGCTAATTATACTTTGCCTCCATCAAGGTCANT
                      ____________________________________________________________
consensus GTATGAAGTTGAAGTTGGGCTGTTTGTTGCTAATTATACTTTGCCTCCATCAAGGTCATT
 
. : . : . : . : . : . :
rJMSF017C03+ ACTTGCCA-ACAATTTTGTTTGCTTACATTTATCCTCAACTCCTTGTAAGTTTGGTTTTA
rJMSF052L12+ ACTTGCCATACAATTTTGTTTGCTTACATTTATCCTCNACTCCTTGTAAGTTTGGTTTTA
                      ____________________________________________________________
consensus ACTTGCCATACAATTTTGTTTGCTTACATTTATCCTCAACTCCTTGTAAGTTTGGTTTTA
 
. : . : . : . : . : . :
rJMSF017C03+ TTTCATCAAATGCGATTGCATGAAATTGGTAGTGTGTATAC
rJMSF052L12+ TTTCATCAAATNCGATNGCATGAAATTGGNAGTGTGTATACTTGGTAGTTNCAATAGTTT
                      ____________________________________________________________
consensus TTTCATCAAATGCGATTGCATGAAATTGGTAGTGTGTATACTTGGTAGTTNCAATAGTTT