Previous Contig 014022:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036N23Sequence595006213 (4)gb:AY096642_15761808e-34Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672572014022 (7)gb:AY096642_15761806e-26Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672
JMFN007N04Sequence427014022 (7)gb:AY096642_15761802e-38Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672
JMFS069F06Sequence642014022 (7)gb:AY096642_15761802e-27Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672
JMSF006N16Sequence242004833 (2)249014022 (7)gb:AP003935_18354958e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P066
JMSF013C02Sequence443014022 (7)gb:AY096642_15761803e-30Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672782005564 (29)gb:AB035183_1518926e-122Ipomoea batatas hcbt mRNA for N-hydroxycinnamoyl/benzoyltransferase, complete cd
JMSF027D12Sequence591014022 (7)gb:AY096642_15761804e-51Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672752023264gb:AY096642_15761802e-26Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672
JMSF052L03Sequence606006213 (4)gb:AY096642_15761803e-34Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672901014022 (7)gb:AY096642_15761801e-54Arabidopsis thaliana unknown protein (At2g34750) mRNA, complete cds.>gb:AY142672

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF013C02+ TTTGACATTGAGCTAGAAGATCTAGAAGGG
                      ____________________________________________________________
consensus TTTGACATTGAGCTAGAAGATCTAGAAGGG
 
. : . : . : . : . : . :
JMSF013C02+ CCCATAGATGATGGTCAGCAAGAGAGTTTTGACTTTGAGATTCAAAGGGACATGTGGATA
                      ____________________________________________________________
consensus CCCATAGATGATGGTCAGCAAGAGAGTTTTGACTTTGAGATTCAAAGGGACATGTGGATA
 
. : . : . : . : . : . :
JMSF013C02+ GACAGATTTTTTGGAGAAAGTGCCAGTGCTCAGAAGTTGGATAGTTTGATGGTGCTCATA
JMSF027D12- GAAAGTGCCAGTGCTCAGAAGTTGGATAGTTTGATGGTGCTCATA
                      ____________________________________________________________
consensus GACAGATTTTTTGGAGAAAGTGCCAGTGCTCAGAAGTTGGATAGTTTGATGGTGCTCATA
 
. : . : . : . : . : . :
JMSF013C02+ TTTGAGTACTTCATATCTTGCAATGAGAGTGGCCGCCTTGGTCGAGTATTTGACACACTT
JMSF027D12- TTTGAGTACTTCATATCTTGCAATGAGAGTGGCCGCCTTGGTCGAGTATTTGACACACTT
                      ____________________________________________________________
consensus TTTGAGTACTTCATATCTTGCAATGAGAGTGGCCGCCTTGGTCGAGTATTTGACACACTT
 
. : . : . : . : . : . :
JMSF013C02+ CTTCTGTCCTTTGAAAAAACTGTTTTGACAGCATACAAGTCTAAATTTGCCCAGTTTGTT
JMSF027D12- CTTCTGTCCTTTGAAAAAACTGTTTTGACAGCATACAAGTCTAAATTTGCCCAGTTTGTT
                      ____________________________________________________________
consensus CTTCTGTCCTTTGAAAAAACTGTTTTGACAGCATACAAGTCTAAATTTGCCCAGTTTGTT
 
. : . : . : . : . : . :
JMSF013C02+ ATGTTCTATGCTTGTTCACTTGATCCTGAGAACTGTGGTAAGAGGTTTGCGAACATGCTC
JMSF027D12- ATGTTCTATGCTTGTTCACTTGATCCTGAGAACTGTGGTAAGAGGTTTGCGAACATGCTC
                      ____________________________________________________________
consensus ATGTTCTATGCTTGTTCACTTGATCCTGAGAACTGTGGTAAGAGGTTTGCGAACATGCTC
 
. : . : . : . : . : . :
JMSF013C02+ ATTCATATATTTGAGACCAGTGTCCATCTTGAATGGAGAATGAGTGCGGTTGCTTATCTT
JMSF027D12- ATTCATATATTTGAGACCAGTGTCCATCTTGAATGGAGAATGAGTGCGGTTGCTTATCTT
                      ____________________________________________________________
consensus ATTCATATATTTGAGACCAGTGTCCATCTTGAATGGAGAATGAGTGCGGTTGCTTATCTT
 
. : . : . : . : . : . :
JMSF013C02+ GCCAGTTATCTGGCTCGTGCAAGGTTTATGGACATGCCATTTGTTGCTG
JMSF027D12- GCCAGTTATCTGGCTCGTGCAAGGTTTATGGACATGCCATTTGTTGCTGACTGTTTGGAA
rJMSF006N16+ TGGAA
rJMSF052L03+ AGTTATCTGGCTCGTGCAAGGTTTATGGACATGCCATTTGTTGCTGACTGTTTGGAA
                      ____________________________________________________________
consensus GCCAGTTATCTGGCTCGTGCAAGGTTTATGGACATGCCATTTGTTGCTGACTGTTTGGAA
 
. : . : . : . : . : . :
JMSF027D12- AGATTGGTGAATTGGTGTTACAATTATTGCAAAAGTAAGACTGGTGAAATTAATCCAAAT
JMFN007N04- ATTAATCCAAAT
rJMSF006N16+ AGATTGGTGAATTGGTGTTACAATTATTGCAAAAGTAAGACTGGNGAAATTAATCCAAAT
rJMSF052L03+ AGATTGGTGAATTGGTGTTATAATTATTGCAAAATTAAAACTGGTGAAATTAATCCAAAT
                      ____________________________________________________________
consensus AGATTGGTGAATTGGTGTTACAATTATTGCAAAAGTAAGACTGGTGAAATTAATCCAAAT
 
. : . : . : . : . : . :
JMSF027D12- CCTAGAGCTCACAAGGATTTCTATGCTGGATGCCAGGCCATAATGTACATAATTTGCTTC
JMFN007N04- CCTAGAGCTCACAAGGATTTCTATGCTGGATGTCAGGCCATAATGTACATAATTTGCTTC
rJMSF006N16+ CCTAGAGCTCACAAGGATTTCTATGCTGGATGCCAGGCCATAATGTACATAATTTGCTTC
rJMSF052L03+ CCTAGAGCTCACAAGGATTTCTATGCTGGATGTCAGGCCATAATGTACATAATTTGCTTC
                      ____________________________________________________________
consensus CCTAGAGCTCACAAGGATTTCTATGCTGGATGTCAGGCCATAATGTACATAATTTGCTTC
 
. : . : . : . : . : . :
JMSF027D12- CGGAGGGGATCCATTCATAGTTTATTCCGTATTAAATCTCATCTCCTGCGCATGCGTATA
JMFN007N04- CGGAGGGGATCCATTCATAGTTTATTCCGTATTAAATCTCATCTCCTGCGCATGCGTATA
rJMSF006N16+ CGGAGGGGATCCATTCATAGTTTATTCCGTATTAAATCTCATCTCCTGCGCATGCGTATA
rJMSF052L03+ CGGAGGGGATCCATTCATAGTTTATTCCGTATTAAATCTCATCTCCTGCGCATGCGTATA
                      ____________________________________________________________
consensus CGGAGGGGATCCATTCATAGTTTATTCCGTATTAAATCTCATCTCCTGCGCATGCGTATA
 
. : . : . : . : . : . :
JMSF027D12- GAGGATATCCTGAGGCATTCATTAAGTCCATTGATGGT
JMFS069F06- GAA
JMFN007N04- GAGGATATCTTGAGGCATTCACTATGTCCATTGATGGTTTGCTTACCATCAATAGTAGAA
rJMSF006N16+ GAGGATATCCTGAGGCATTCATTAAGTCCATTGATGGT
rJMSF052L03+ GAGGATATCTTGAGGCATTCACTATGTCCATTGATGGTTTGCTTACCATCAATAGTAGAA
                      ____________________________________________________________
consensus GAGGATATCTTGAGGCATTCATTATGTCCATTGATGGTTTGCTTACCATCAATAGTAGAA
 
. : . : . : . : . : . :
JMFS069F06- GAATTCCTTAGGGTGGCAGAAACTACATGTTTATTTAGTTTCCCAGAGAACAATGCCCCC
rJMFF036N23+ CAATGCCCCC
JMFN007N04- GAATTCCTTAGGGTGGCAGAAACTACATGTTTATTTAGTTTCCCAGAGAACAATGCCCCC
rJMSF052L03+ GAATTCCTTAGGGTGGCAGAAACTACATGTTTATTTAGTTTCCCAGAGAACAATGCCCCC
                      ____________________________________________________________
consensus GAATTCCTTAGGGTGGCAGAAACTACATGTTTATTTAGTTTCCCAGAGAACAATGCCCCC
 
. : . : . : . : . : . :
JMFS069F06- ATTGGTAGTGGTCTACTCGAGTCGGAAGTTTCAATGGCATTTGGTGGGAATCAGAGGCTT
rJMFF036N23+ ATTGGTAGTGGTNTACTCGAGTCGGAAGTTTCAATGGCATTTGGTGGGAATCAGAGGCTT
JMFN007N04- ATTGGTAGTGGTCTACTCGAGTCGGAAGTTTCAATGGCATTTGGTGGGAATCAGAGGCTT
rJMSF052L03+ ATTGGTAGTGGTCTACTCGAGTCGGAAGTTTCAATGGCATTTGGTGGGAATCAGAGGCTT
                      ____________________________________________________________
consensus ATTGGTAGTGGTCTACTCGAGTCGGAAGTTTCAATGGCATTTGGTGGGAATCAGAGGCTT
 
. : . : . : . : . : . :
JMFS069F06- GACACGTTTTTCCCATTTGACCCATGTTTGCTAAAGAAATCTGACAGGTTTATCAGGCCA
rJMFF036N23+ GACACGTTTTTCCCATTTGACCCATGTTTGCTAAAGAAATCTGACAGGTTTATCAGGCCA
JMFN007N04- GACACGTTTTTCCCATTTGACCCATGTTTGCTAAAGAAATCTGACAGGTTTATCAGGCCA
rJMSF052L03+ GACACGTTTTTCCCATTTGACCCATGTTTGCTAAAGAAATCTGACAGGTTTATCAGGCCA
                      ____________________________________________________________
consensus GACACGTTTTTCCCATTTGACCCATGTTTGCTAAAGAAATCTGACAGGTTTATCAGGCCA
 
. : . : . : . : . : . :
JMFS069F06- AACTTCATATACTGGTCCATGGTTAGAAATACTTATGACGAGGTTGAGGATGATGAATGC
rJMFF036N23+ AACTTCATATACTGGTCCATGGTTAGAAATACTTATGACGAGGTTGAGGATGATGAATGC
JMFN007N04- AACTTCATATACTGGTCCATGGTTAGAAATACTTATGACGAGGCTGAGGATGATG
rJMSF052L03+ AACTTCATATACTGGTCCATGGTTAGAAATACTTATGACGAGGTTGAGGATGATGAATGC
                      ____________________________________________________________
consensus AACTTCATATACTGGTCCATGGTTAGAAATACTTATGACGAGGTTGAGGATGATGAATGC
 
. : . : . : . : . : . :
JMFS069F06- ACTAGCGATGAGGATGAGGTTGAAGTTTGCATTCCTGGGAATGGTATGGACATAGTCGAT
rJMFF036N23+ ACTAGCGATGAGGATGAGGTTGAAGTTTGCATTCCTGGGAATGGTATGGACATAGTCGAT
rJMSF052L03+ ACTAGCGATGAGGATGAGGTTGAAGTTTGCATTCCTGGGAATGGTATGGACATAGTCGAT
                      ____________________________________________________________
consensus ACTAGCGATGAGGATGAGGTTGAAGTTTGCATTCCTGGGAATGGTATGGACATAGTCGAT
 
. : . : . : . : . : . :
JMFS069F06- GGGGGAGCTCCCCGGAGTTGTCATGGTGACAACGGGAATCTTGAGGTTGAATTTGATTAC
rJMFF036N23+ GGAGGAGCTCCCCGGAGTTGTCATGGTGACAACGGGAATCTTGAGGTTGAATTTGATTAC
rJMSF052L03+ GGAGGAGCTCCCCGGAGTTGTCATGGTGACAACGGGAATCTTGAGGTTGAATTTGATTAC
                      ____________________________________________________________
consensus GGAGGAGCTCCCCGGAGTTGTCATGGTGACAACGGGAATCTTGAGGTTGAATTTGATTAC
 
. : . : . : . : . : . :
JMFS069F06- AACCTGAACAAGATGTCTATAACTCCGAAAAATACATTACTCCAACGATTTGGAGGTGAA
rJMFF036N23+ AACCTGAACAAGATGTCTATAACTCCGAAAAATACATTACTCCAACGATTTGGAGGTGAA
rJMSF052L03+ AACCTGAACAAGATGTCTATAACTCCGAAAAATACATTACTCCAACGATTTGGAGGTGAA
                      ____________________________________________________________
consensus AACCTGAACAAGATGTCTATAACTCCGAAAAATACATTACTCCAACGATTTGGAGGTGAA
 
. : . : . : . : . : . :
JMFS069F06- GGTGCAGGTTTGCGGATGCCCTCAAGAATCCGACCTTGCCCTGATTCTTTGTGATGGA
rJMFF036N23+ GGTGCAGGTTTGCGGATGCCCTCAAGAATCCGACCTTGCCCTGATTCTTTGTGATGGA
rJMSF052L03+ GGTGCAGGTTTGCGGATGCCCTCAAGAATCCGACCTTGCCCTGATTCTTTGTGATGGATG
                      ____________________________________________________________
consensus GGTGCAGGTTTGCGGATGCCCTCAAGAATCCGACCTTGCCCTGATTCTTTGTGATGGATG
 
. : . : . : . : . : . :
rJMSF052L03+ GCCCGTTGTCCTTCAGTTTTGCTTTGTGCTGTGCGTAGTAGCCTAGTAGGTAATTGTAAA
                      ____________________________________________________________
consensus GCCCGTTGTCCTTCAGTTTTGCTTTGTGCTGTGCGTAGTAGCCTAGTAGGTAATTGTAAA
 
. : . : . : . : . : . :
rJMSF052L03+ ATATATAGGAGCTTCAACATTAGTCTCAATTTTGTGGAGTAGCGCAATCTTCTGCTCCAT
                      ____________________________________________________________
consensus ATATATAGGAGCTTCAACATTAGTCTCAATTTTGTGGAGTAGCGCAATCTTCTGCTCCAT