Previous Contig 014013:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF051I02Sequence673014013 (3)gb:AY085276_15703481e-42Arabidopsis thaliana clone 142381 mRNA, complete sequence.725014013 (3)gb:AY085276_15703482e-11Arabidopsis thaliana clone 142381 mRNA, complete sequence.
JMSF052I01Sequence657020611gb:AY085276_15703484e-14Arabidopsis thaliana clone 142381 mRNA, complete sequence.906014013 (3)gb:AY085276_15703481e-11Arabidopsis thaliana clone 142381 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051I02- GGGCAATGCACCAAAAACCAGGCCTCTTTCC
                      ____________________________________________________________
consensus GGGCAATGCACCAAAAACCAGGCCTCTTTCC
 
. : . : . : . : . : . :
JMSF051I02- CATCCCTATAAGTCCTCTGTCATTCATCTTCCAAAATTAGGGTTTTACAAAGGGGGAAAG
                      ____________________________________________________________
consensus CATCCCTATAAGTCCTCTGTCATTCATCTTCCAAAATTAGGGTTTTACAAAGGGGGAAAG
 
. : . : . : . : . : . :
JMSF051I02- TATGGCGAAGAAGAGGAAATCCGAGGCTACGCGGTTGGATGAGGTGGATCGAACTCTTCA
                      ____________________________________________________________
consensus TATGGCGAAGAAGAGGAAATCCGAGGCTACGCGGTTGGATGAGGTGGATCGAACTCTTCA
 
. : . : . : . : . : . :
JMSF051I02- CTCAACTTTTTGCAGCGCCGCTAACTCTTTATCGCAACTCTACACTCAGGCCATGCACCA
                      ____________________________________________________________
consensus CTCAACTTTTTGCAGCGCCGCTAACTCTTTATCGCAACTCTACACTCAGGCCATGCACCA
 
. : . : . : . : . : . :
JMSF051I02- CCAGCGGATTTCCTCTCAGGCTGGCGAGCGCCACGCGCTTGAGAAACTTTATAATTGGAT
                      ____________________________________________________________
consensus CCAGCGGATTTCCTCTCAGGCTGGCGAGCGCCACGCGCTTGAGAAACTTTATAATTGGAT
 
. : . : . : . : . : . :
JMSF051I02- TTTAAGACAGCAAGAAGATGGAGCAAAAGTGACCACTGCTGATATAGTTGCTTATGTACA
rJMSF052I01+ A
                      ____________________________________________________________
consensus TTTAAGACAGCAAGAAGATGGAGCAAAAGTGACCACTGCTGATATAGTTGCTTATGTACA
 
. : . : . : . : . : . :
JMSF051I02- GAATGAGCTTGACTATGGAGCTGAGGAAACCCCAACGTCTCCCAGGTCATCATTCCAAGA
rJMSF051I02+ AGGAAACCCCAACGTCTCCCAGGTCATCATTCCAAGA
rJMSF052I01+ GAATGAGCTTGACTATGGAGCTGAGGAAACCCCAACGTCTCCCAGGTCATCATTCCAAGA
                      ____________________________________________________________
consensus GAATGAGCTTGACTATGGAGCTGAGGAAACCCCAACGTCTCCCAGGTCATCATTCCAAGA
 
. : . : . : . : . : . :
JMSF051I02- GCAACAGCCTCAAATTACCATGCATTTACCAAATGGAGGGTTT-CCCGTTAATCCTAACC
rJMSF051I02+ GCAACAGCCTCAAATTACCATGCA-TTACCAAATGGAGGGTTTCCCCGTTAATCCTAACC
rJMSF052I01+ GCAACAGCCTCAAATTACCATGCATTTACCAAATGGAGGGTTT-CCCGTTAATCCTAACC
                      ____________________________________________________________
consensus GCAACAGCCTCAAATTACCATGCATTTACCAAATGGAGGGTTT-CCCGTTAATCCTAACC
 
. : . : . : . : . : . :
JMSF051I02- CCTTTTGTCCAGCAAGTGCTCCCCAGGGACTCCGTTCTGGCCACTCTGATCACCAACCAA
rJMSF051I02+ CCTTTTGTCCAGCAAGTGCTCCCCAGGGACTCCGTTCTGGCCACTCTGATCACCAACCAA
rJMSF052I01+ CCTTTTGTCCAGCAAGTGCTCCCCAGGGACTCCGTTCTGGCCACTCTGATCACCAACCAA
                      ____________________________________________________________
consensus CCTTTTGTCCAGCAAGTGCTCCCCAGGGACTCCGTTCTGGCCACTCTGATCACCAACCAA
 
. : . : . : . : . : . :
JMSF051I02- AGAGCTCCGTCTTTTCAAATGCTCTATCCAGTCCTATTCGTGGGAGCCTCCAGCACTATC
rJMSF051I02+ AGAGCTCCGTCTTTTCAAATGCTCTATCCAGTCCTATTCGTGGGAGCCTCCAGCACTATC
rJMSF052I01+ AGAGCTCCGTCTTTTCAAATGCTCTATCCAGTCCTATTCGTGGGAGCCTCCAGCACTATC
                      ____________________________________________________________
consensus AGAGCTCCGTCTTTTCAAATGCTCTATCCAGTCCTATTCGTGGGAGCCTCCAGCACTATC
 
. : . : . : . : . : . :
JMSF051I02- ATTTGGCGCAGGGAAGTTACCCCCCAAACAACGCCATGCCATCTGCATGTGGGATGCAAA
rJMSF051I02+ ATTTGGCGCAGGGAAGTTACCCCCCAAACAACGCCATGCCATCTGCATGTGGGATGCAAA
rJMSF052I01+ ATTTGGCGCAGGGAAGTTACCCCCCAAACAACGCCATGCCATCTGCATGTGGGATGCAAA
                      ____________________________________________________________
consensus ATTTGGCGCAGGGAAGTTACCCCCCAAACAACGCCATGCCATCTGCATGTGGGATGCAAA
 
. : . : . : . : . : . :
JMSF051I02- ATAATGATACCGGTTATCTCCAAAGCCGGGATGCCAATCCTCC
rJMSF051I02+ ATAATGATACCGGTTATCTCCAAAGCCGGGATGCCAATCCTCCAAACTCCTCCGACACTT
rJMSF052I01+ ATAATGATACCGGTTATCTCCAAAGCCGGGATGCCAATCCTCCAAACTCCTCCGACACTT
                      ____________________________________________________________
consensus ATAATGATACCGGTTATCTCCAAAGCCGGGATGCCAATCCTCCAAACTCCTCCGACACTT
 
. : . : . : . : . : . :
rJMSF051I02+ TGATGGACATGCATTCTGATACTCCTGACCATGAATTTCCCTACTAAAGGTTTAGGTTAT
rJMSF052I01+ TGATGGACATGCATTCTGATACTCCTGACCATGAATTTCCCTACTAAAGGTTTAGGTTAT
                      ____________________________________________________________
consensus TGATGGACATGCATTCTGATACTCCTGACCATGAATTTCCCTACTAAAGGTTTAGGTTAT
 
. : . : . : . : . : . :
rJMSF051I02+ ATTCTGATGCTTCAAGATGTTCTGCACTTTCCCGCTAAGAATGCAAATGCACATAGTATA
rJMSF052I01+ ATTCTGATGCTTCAAGATGTTCTGCACTTTCCCGCTAAGAATGCAAATGCACATAGTATA
                      ____________________________________________________________
consensus ATTCTGATGCTTCAAGATGTTCTGCACTTTCCCGCTAAGAATGCAAATGCACATAGTATA
 
. : . : . : . : . : . :
rJMSF051I02+ CACACTCGTCTAACTGGAGACGAGCAAAGATGAAAGGTGGTTGCGAAATGCAGTCCTTGG
rJMSF052I01+ CACACTCGTCTAACTGGAGACGAGCAAAGATGAAAGGTGGTTGCGAAATGCAGTCCTTGG
                      ____________________________________________________________
consensus CACACTCGTCTAACTGGAGACGAGCAAAGATGAAAGGTGGTTGCGAAATGCAGTCCTTGG
 
. : . : . : . : . : . :
rJMSF051I02+ CAAAGTGCGTGACTAGTTGTCAGTATGCTGCTAATTTATACATGCTGGTAAAATTGTGTA
rJMSF052I01+ CAAAGTGCGTGACTAGTTGTCAGTATGCTGCTAATTTATACATGCTGGTAAAATTGTGTA
                      ____________________________________________________________
consensus CAAAGTGCGTGACTAGTTGTCAGTATGCTGCTAATTTATACATGCTGGTAAAATTGTGTA
 
. : . : . : . : . : . :
rJMSF051I02+ ATGTTAGTGATTGGTATATGTTGTTGCAGGTTGCCTTTTCGTCCTGTCTTGATATTTTAT
rJMSF052I01+ ATGTTAGTGATTGGTATATGTTGTTGCAGGTTGCCTTTTCGTCCTGTCTTGATATTTTAT
                      ____________________________________________________________
consensus ATGTTAGTGATTGGTATATGTTGTTGCAGGTTGCCTTTTCGTCCTGTCTTGATATTTTAT
 
. : . : . : . : . : . :
rJMSF051I02+ CTTTTGCTTTTGTTTTACAATTGTGGTTGCAATATTTTTATGTGATTTTTTTAGTTAAAA
rJMSF052I01+ CTTTTGCTTTTGTTTTACAATTGTGGTTGCAATATTTTTATGTGATTTTTTTAGTTAAAA
                      ____________________________________________________________
consensus CTTTTGCTTTTGTTTTACAATTGTGGTTGCAATATTTTTATGTGATTTTTTTAGTTAAAA
 
. : . : . : . : . : . :
rJMSF051I02+ TCTTGTTTCTGTTTTGTCTTTGGTTGGTT
rJMSF052I01+ TCTTGTTTCTGTTTTGTCTTTGGTTGGTTTGTACATTATTATTGTTAATATTTAACCTAC
                      ____________________________________________________________
consensus TCTTGTTTCTGTTTTGTCTTTGGTTGGTTTGTACATTATTATTGTTAATATTTAACCTAC