Previous Contig 014007:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006D24Sequence556001417 (10)gb:AX765868_14746231e-66Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen759014007 (11)gb:AY062093_15649651e-78Arabidopsis thaliana AT5g64760/MVP7_9 mRNA, complete cds.>gb:AY062113_1564978 Ar
JMFF018C08Sequence573001417 (10)gb:AX765868_14746232e-65Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen770014007 (11)gb:AY062093_15649653e-78Arabidopsis thaliana AT5g64760/MVP7_9 mRNA, complete cds.>gb:AY062113_1564978 Ar
JMFF022E06Sequence185001417 (10)gb:AC096688_17362474e-04Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete sequence.730014007 (11)gb:AY062093_15649653e-74Arabidopsis thaliana AT5g64760/MVP7_9 mRNA, complete cds.>gb:AY062113_1564978 Ar
JMFF031D09Sequence521001417 (10)gb:AX765868_14746231e-51Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen729014007 (11)gb:AY062093_15649652e-80Arabidopsis thaliana AT5g64760/MVP7_9 mRNA, complete cds.>gb:AY062113_1564978 Ar
JMFF034A08Sequence655014007 (11)gb:AY062093_15649656e-53Arabidopsis thaliana AT5g64760/MVP7_9 mRNA, complete cds.>gb:AY062113_1564978 Ar
JMFF043M16Sequence619001417 (10)gb:AX765868_14746231e-77Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen550014007 (11)gb:AX765868_14746235e-30Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen
JMFF050A23Sequence595001417 (10)gb:AX765868_14746234e-65Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen606014007 (11)gb:AY062093_15649655e-56Arabidopsis thaliana AT5g64760/MVP7_9 mRNA, complete cds.>gb:AY062113_1564978 Ar
JMFF051J14Sequence577001417 (10)gb:AX765868_14746232e-68Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen522014007 (11)gb:AX765868_14746237e-30Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen
JMSF034B15Sequence696001417 (10)gb:AX765868_14746234e-87Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen755014007 (11)gb:AY062093_15649655e-81Arabidopsis thaliana AT5g64760/MVP7_9 mRNA, complete cds.>gb:AY062113_1564978 Ar
JMSF048M07Sequence661001417 (10)gb:AX765868_14746237e-85Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen767014007 (11)gb:AY062093_15649659e-67Arabidopsis thaliana AT5g64760/MVP7_9 mRNA, complete cds.>gb:AY062113_1564978 Ar
JMSF052G14Sequence706001417 (10)gb:AX765868_1474623e-100Sequence 77 from Patent WO03008440.>gb:AB016893_1513257 Arabidopsis thaliana gen959014007 (11)gb:AC096688_17362472e-95Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052G14+ AT
                      ____________________________________________________________
consensus AT
 
. : . : . : . : . : . :
rJMSF052G14+ ATGAGATACCTTCTGTAAAAGAAGACCCAGAAAAATGGATACCGGTGCTAAGGAAAATAT
                      ____________________________________________________________
consensus ATGAGATACCTTCTGTAAAAGAAGACCCAGAAAAATGGATACCGGTGCTAAGGAAAATAT
 
. : . : . : . : . : . :
rJMFF022E06+ CCT
rJMFF006D24+ CCTATGCAATCAAGCCTTCATAACTCTACCT
rJMFF018C08+ CCACATGATCNTATGCAATCAAGCCTTCATAACTNTACCT
rJMSF034B15+ CCACATGATCCTATGCAATCCAGCCTTCATAACTCTACCT
rJMFF031D09+ CCACATGATCCTATGCAATCAAGCCTTCATAACTCTACCT
rJMSF052G14+ GCTGGTACCTGGTTCTGTCTCCACATGATCCTATGCAATCAAGCCTTCATAACTCTACCT
                      ____________________________________________________________
consensus GCTGGTACCTGGTTCTGTCTCCACATGATCCTATGCAATCAAGCCTTCATAACTCTACCT
 
. : . : . : . : . : . :
rJMFF022E06+ TGGAGGATAAGAACCTTTCAGAAATCCCTCATTTCAAGGTGCTATTGAAACAATTAATTA
rJMFF006D24+ TGGAGGATAAGAACCTTTCAGAAATCCCTCATTTCAAGGTGCTATTGAAACAATTAATTA
rJMFF018C08+ NGGAGGATAAGAACCTTTCAGAAATCCNTCATTTCAAGGTGCTATTGAAACAATTAATTA
rJMSF048M07+ TGAAACAATTNATTA
rJMSF034B15+ TGGAGGATAAGAACCTTTCAGAAATCCCTCATTTCAAGGTGCTATTGAAACAATTAATTA
rJMFF031D09+ GGGAGGATAAGAACCTTTCAGAAATCCCTCATTTCAAGGTGCTATTGAAACAATTAATTA
rJMSF052G14+ TGGAGGATAAGAACCTTTCAGAAATCCCTCATTTCAAGGTGCTATTGAAACAATTAATTA
                      ____________________________________________________________
consensus TGGAGGATAAGAACCTTTCAGAAATCCCTCATTTCAAGGTGCTATTGAAACAATTAATTA
 
. : . : . : . : . : . :
rJMFF022E06+ CCATGGAGGTTATTCAGTGGACTGCTTTGTGGAACACATTCAAGGATGAGTTTGAGAATG
rJMFF050A23+ TCAAGGATGAGTTGNAGAATG
rJMFF006D24+ CCATGGAGGTTATTCAGTGGACTGCTTTGTGGAACACATTCAAGGATGAGTTTGAGAATG
rJMFF018C08+ CCATGGAGGTTATTCAGTGGACTGCTTTGTGGAACACATTCAAGGATGAGTTTGAGAATG
rJMFF034A08+ ATG
rJMSF048M07+ CCATGGAGGTTATTCAGTGGACTGCTTTGTGGAACACATTCAAGGATGAGTTTGAGAATG
rJMSF034B15+ CCATGGAGGTTATTCAGTGGACTGCTTTGTGGAACACATTCAAGGATGAGTTTGAGAATG
rJMFF031D09+ CCATGGAGGTTATTCAGTGGACTGCTTTGTGGAACACATTCAAGGATGAGTTTGAGAATG
rJMSF052G14+ CCATGGAGGTTATTCAGTGGGCTGCTTTGTGGAACACATTCAAGGATGAGTTTGAGAATG
                      ____________________________________________________________
consensus CCATGGAGGTTATTCAGTGGACTGCTTTGTGGAACACATTCAAGGATGAGTTTGAGAATG
 
. : . : . : . : . : . :
rJMFF022E06+ AAAAGAATATGCTTGGTGGCTCCTTAGGTGACAAGGCAGCTGAAGATCTTAGACTGAGAG
rJMFF050A23+ AAAAGAATATGCTTGGTGGCTCCTTAGGTGACAAGGCAGCTGAAGATCTTAGACTGAGAG
rJMFF006D24+ AAAAGAATATGCTTGGTGGCTCCTTAGGTGACAAGGCAGCTGAAGATCTTAGACTGAGAG
rJMFF018C08+ AAAAGAATATGCTTGGTGGCTCCTTAGGTGACAAGGCAGCTGAAGATCTTAGACTGAGAG
rJMFF034A08+ AAAAGAATATGCTTGGTGGCTCNTTAGGTGACAAGGCAGCTGAAGATCTTAGACTGAGAG
rJMSF048M07+ AAAAGAATATGCTTGGTGGCTCCTTAGGTGACAAGGCAGCTGAAGATCTTAGACTGAGAG
rJMSF034B15+ AAAAGAATATGCTTGGTGGCTCCTTAGGTGACAAGGCAGCTGAAGATCTTAGACTGAGAG
rJMFF031D09+ AAAAGAATATGCTTGGTGGCTCCTTAGGTGACAAGGCAGCTGAAGATCTTAGACTGAGAG
rJMSF052G14+ AAAAGAATATGCTTGGTGGCTCCTTAGGTGACAAGGCAGCTGAAGATCTTAGACTGAGAG
                      ____________________________________________________________
consensus AAAAGAATATGCTTGGTGGCTCCTTAGGTGACAAGGCAGCTGAAGATCTTAGACTGAGAG
 
. : . : . : . : . : . :
rJMFF022E06+ TTATTGAACATAACATCCTTGTCGTGTCAAAGTATTATTCACGAATAACCTTGAACAGAC
rJMFF050A23+ TTATTGAACATAACATCCTNGTCGTGTCAAAGTATTATTCACGAATAACCTTGAACAGAC
rJMFF006D24+ TTATTGAACATAACATCCTTGTCGTGTCAAAGTATTATTCACGAATAACCTTGAACAGAC
rJMFF018C08+ TTATTGAACATAACATCCTTGTCGTGTCAAAGTATTATTCACGAATAACCTTGAACAGAC
rJMFF034A08+ TTATTGAACATAACATCCTTGTCGTGTCAAAGTATTATTCACGAATAACCTTGAACAGAC
rJMSF048M07+ TTATTGAACATAACATCCTTGTCGTGTCAAAGTATTATTCACGAATAACCTTGAACAGAC
rJMSF034B15+ TTATTGAACATAACATCCTTGTCGTGTCAAAGTATTATTCACGAATAACCTTGAACAGAC
rJMFF031D09+ TTATTGAACATAACATCCTTGTCGTGTCAAAGTATTATTCACGAATAACCTTGAACAGAC
rJMSF052G14+ TTATTGAACATAACATCCTTGTCGTGTCAAAGTATTATTCACGAATAACCTTGAACAGAC
                      ____________________________________________________________
consensus TTATTGAACATAACATCCTTGTCGTGTCAAAGTATTATTCACGAATAACCTTGAACAGAC
 
. : . : . : . : . : . :
rJMFF022E06+ TATCAAATCTGCTCTGTCTTACTATTCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
rJMFF050A23+ TATCAAATCTGCTCTGTCTTACTATTCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
rJMFF006D24+ TATCAAATCTGCTCTGTCTTACTATTCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
rJMFF018C08+ TATCAAATCTGCTCTGTCTTACTATTCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
rJMFF034A08+ TATCAAATCTGCTCTGTCTTACTATTCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
rJMFF051J14+ GGAAGCAGAAAAGCATCTATCAGAAATGGTTG
rJMSF048M07+ TATCAAATCTGCTCTGTCTTACTATTCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
rJMSF034B15+ TATCAAATCTGCTCTGTCTTACTATTCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
rJMFF031D09+ TATCAAATCTGCTCTGTCTTACTATTCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
rJMFF043M16+ TCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
rJMSF052G14+ TATCAAATCTGCTCTGTCTTACTATTCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
                      ____________________________________________________________
consensus TATCAAATCTGCTCTGTCTTACTATTCAGGAAGCAGAAAAGCATCTATCAGAAATGGTTG
 
. : . : . : . : . : . :
rJMFF022E06+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
rJMFF050A23+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
rJMFF006D24+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
rJMFF018C08+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
rJMFF034A08+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
rJMFF051J14+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
rJMSF048M07+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
rJMSF034B15+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
rJMFF031D09+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
rJMFF043M16+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
rJMSF052G14+ TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
                      ____________________________________________________________
consensus TATCCAAAGCACTGGTTGCAAAGATTGACAGGCCAATGGGTATTGTCTGCTTCCAACCAG
 
. : . : . : . : . : . :
rJMFF022E06+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
rJMFF050A23+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
rJMFF006D24+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
rJMFF018C08+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
rJMFF034A08+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAGCTTGGAGAAACTACTTGACC
rJMFF051J14+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
rJMSF048M07+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
rJMSF034B15+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
rJMFF031D09+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
rJMFF043M16+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
rJMSF052G14+ CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
                      ____________________________________________________________
consensus CAAAAGACAGTAATGATATTTTAAATTCATGGGCGTCGAACTTGGAGAAACTACTTGACC
 
. : . : . : . : . : . :
rJMFF022E06+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
rJMFF050A23+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
rJMFF006D24+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
rJMFF018C08+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
rJMFF034A08+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
rJMFF051J14+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
rJMSF048M07+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
rJMSF034B15+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
rJMFF031D09+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
rJMFF043M16+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
rJMSF052G14+ TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
                      ____________________________________________________________
consensus TTGTAGAGAAGAGTTGTCACCAGATCCACAAAGAAATGATGGTCCATAAAGCTGCACTAA
 
. : . : . : . : . : . :
rJMFF022E06+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
rJMFF050A23+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
rJMFF006D24+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
rJMFF018C08+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
rJMFF034A08+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
rJMFF051J14+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
rJMSF048M07+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
rJMSF034B15+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
rJMFF031D09+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
rJMFF043M16+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGTTCTTATGACCCATTTTGAGGAGCATT
rJMSF052G14+ AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
                      ____________________________________________________________
consensus AAGCTTGAGATAATACCAGTAACTTCAGGACTGCTCTTATGACCCATTTTGAGGAGCATT
 
. : . : . : . : . : . :
rJMFF022E06+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
rJMFF050A23+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
rJMFF006D24+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
rJMFF018C08+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
rJMFF034A08+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
rJMFF051J14+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
rJMSF048M07+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
rJMSF034B15+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
rJMFF031D09+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
rJMFF043M16+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
rJMSF052G14+ GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
                      ____________________________________________________________
consensus GGCAGAACCTGGAAGCGGACATTACTGCTGTTATATTGCTGCTTGCTTCTTGCATCTTAA
 
. : . : . : . : . : . :
rJMFF022E06+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
rJMFF050A23+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
rJMFF006D24+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
rJMFF018C08+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
rJMFF034A08+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
rJMFF051J14+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
rJMSF048M07+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
rJMSF034B15+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
rJMFF031D09+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
rJMFF043M16+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
rJMSF052G14+ TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
                      ____________________________________________________________
consensus TACTTGTGACATTTGCACGGTTTCTGCCAAGTGCTTTTTATGTACTTCTTGTATGCCTTT
 
. : . : . : . : . : . :
rJMFF022E06+ GGTGATTGAATTGATTGTGATCAA-CAAGATTTTAGATTTGGTGACATCACATACTTGCT
rJMFF050A23+ GGTGATTGAATTGATTGTGATCAA-CAAGATTTTAGATTTGGTGAC
rJMFF006D24+ GGTGATTGAATTGATTGTGATCAA-CAAGATTTTAGATTTGGTGACATCACATACTTGCT
rJMFF018C08+ GGTGATTGAATTGATTGTGATCAA-CAAGATTTTAGATTTGGTGACATCACATACTTGCT
rJMFF034A08+ GGTGATTGAATTGATTGTGATCAA-CAAGATTTTAGATTTGGTGACATCACATACTTGCT
rJMFF051J14+ GGTGATTGAATTGATTGTGATCAA-CAAGATTTTAGATTTGGTGACATCACATACTTGCT
rJMSF048M07+ GGTGATTGAATTGATTGTGATCAA-CAAGATTTTAGATTTGGTGACATCACATACTTGCT
rJMSF034B15+ GGTGATTGAATTGATTGTGATCAACCAAGATTTTAGATTTGGTGACATCACATAC
rJMFF031D09+ GGTGATTGAATTGATTGTGATCAA-CAAGA
rJMFF043M16+ GGTGATTGAATTGATTGTGATCAA-CAAGATTTTAGATTTGGTGACATCACATACTTGCT
rJMSF052G14+ GGTGATTGAATTGATTGTGATCAA-CAAGATTTTAGATTTGGTGACATCACATACTTGCT
                      ____________________________________________________________
consensus GGTGATTGAATTGATTGTGATCAA-CAAGATTTTAGATTTGGTGACATCACATACTTGCT
 
. : . : . : . : . : . :
rJMFF022E06+ TACATGCT
rJMFF006D24+ TACATGCTA
rJMFF018C08+ TACATGCTA
rJMFF034A08+ TACATGCTATTTACTTATTGATTAGGGCACAAACTCTCTTAGTTTATT
rJMFF051J14+ TACATGCTATTTACTTATTGATTAGGGCACAAA
rJMSF048M07+ TACATGCTATTTACTTATTGATTAGGGCACAAACTCTCTTAGTTTATTTCAAAATGTGAC
rJMFF043M16+ TACATGCTATTTACTTATTGATTAGGGCACAAACTCTCTTAGTTTATTTCAAAATGTGAC
rJMSF052G14+ TACATGCTATTTACTTATTGATTAGGGCACAAACTCTCTTAGTTTATTTCAAAATGTGAC
                      ____________________________________________________________
consensus TACATGCTATTTACTTATTGATTAGGGCACAAACTCTCTTAGTTTATTTCAAAATGTGAC
 
. : . : . : . : . : . :
rJMSF048M07+ ACTTTTAATTGCTT
rJMFF043M16+ ACTTTTAATTGCTTATTTTGATTCCATTCCTCGGTC
rJMSF052G14+ ACTTTTAATTGCT--TTTTGATTCCATTCCTCGGTCAATTGTGGATATATTGCATAAAAG
                      ____________________________________________________________
consensus ACTTTTAATTGCTTATTTTGATTCCATTCCTCGGTCAATTGTGGATATATTGCATAAAAG