Previous Contig 014005:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016E06Sequence569005509 (10)gb:AB012867_15119616e-45Brassica rapa mRNA for SLL2-S9-protein, complete cds.768014005 (4)gb:AB012867_15119611e-68Brassica rapa mRNA for SLL2-S9-protein, complete cds.
JMSF014O21Sequence317005509 (10)gb:AB012867_15119614e-18Brassica rapa mRNA for SLL2-S9-protein, complete cds.771014005 (4)gb:AB012867_15119611e-68Brassica rapa mRNA for SLL2-S9-protein, complete cds.
JMSF014O22Sequence295005509 (10)gb:AB012867_15119618e-16Brassica rapa mRNA for SLL2-S9-protein, complete cds.771014005 (4)gb:AB012867_15119611e-68Brassica rapa mRNA for SLL2-S9-protein, complete cds.
JMSF052G10Sequence628005509 (10)gb:D88747_16751552e-51Arabidopsis thaliana mRNA for AR401, complete cds.954014005 (4)gb:AB012867_15119615e-68Brassica rapa mRNA for SLL2-S9-protein, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014O21+ CAAATCACATA-GGGGATACCAATTCAAT
rJMSF014O22+ TACCAAATCACATA-GGGGATACCAATTCAAT
rJMSF052G10+ ATTGATATTGCCCTAGGTCACTTACCAAATCACATAGGGGGATACCAATTCAAT
                      ____________________________________________________________
consensus ATTGATATTGCCCTAGGTCACTTACCAAATCACATA-GGGGATACCAATTCAAT
 
. : . : . : . : . : . :
rJMSF014O21+ TCCTGCCGGGCATCTTGAAAAAGACTTGTCTAAATGGAGTGTGCTTGACATTGGGACTGG
rJMSF014O22+ TCCTGCCGGGCATCTTGAAAAAGACTTGTCTAAATGGAGTGTGCTTGACATTGGGACTGG
rJMFF016E06+ CATCTTGAAAAAGACTTGTCTAAATGGAGTGTGCTTGACATTGGGACTGG
rJMSF052G10+ TCCTGCCGGGCATCTTGAAGAAGACTTGTCTAAATGGAGTGTGCTTGACATTGGGACTGG
                      ____________________________________________________________
consensus TCCTGCCGGGCATCTTGAAAAAGACTTGTCTAAATGGAGTGTGCTTGACATTGGGACTGG
 
. : . : . : . : . : . :
rJMSF014O21+ CAATGGCTTGCTTCTTCAAGAGCTTGCTAAACAGGGGTTCTCTGATCTCACTGGAACTGA
rJMSF014O22+ CAATGGCTTGCTTCTTCAAGAGCTTGCTAAACAGGGGTTCTCTGATCTCACTGGAACTGA
rJMFF016E06+ CAATGGCTTGCTTCTTCAAGAGCTTGCTAAACAGGGGTTCTCTGATCTCACTGGAACTGA
rJMSF052G10+ CAATGGCTTGCTTCTTCAAGAGCTTGCTAAACAGGGGTTCTCTGATCTCACTGGAACTGA
                      ____________________________________________________________
consensus CAATGGCTTGCTTCTTCAAGAGCTTGCTAAACAGGGGTTCTCTGATCTCACTGGAACTGA
 
. : . : . : . : . : . :
rJMSF014O21+ CTATAGTGAAGGAGCAGTTGACCTTGCTCGAAATCTTGCTGATCGTGATGGTTTCCCTGA
rJMSF014O22+ CTATAGTGAAGGAGCAGTTGACCTTGCTCGAAATCTTGCTGATCGTGATGGTTTCCCTGA
rJMFF016E06+ CTATAGTGAAGGAGCAGTTGACCTTGCTCGAAATCTTGCTGATCGTGATGGTTTCCCTGA
rJMSF052G10+ CTATAGTGAAGGAGCAGTTGACCTTGCTCGAAATCTTGCTGATCGTGATGGTTTCCCTGA
                      ____________________________________________________________
consensus CTATAGTGAAGGAGCAGTTGACCTTGCTCGAAATCTTGCTGATCGTGATGGTTTCCCTGA
 
. : . : . : . : . : . :
rJMSF014O21+ TATCAAATTCTTGGTCGATGACATTCTTGAAACAAAGTTAGATAGGAAGTTTCAGCTTGT
rJMSF014O22+ TATCAAATTCTTGGTCGATGACATTCTTGAAACAAAGTTAGATAGGAAGTTTCAGCTTGT
rJMFF016E06+ TATCAAATTCTTGGTCGATGACATTCTTGAAACAAAGTTAGATAGGAAGTTTCAGCTTGT
rJMSF052G10+ TATCAAATTCTTGGTCGATGACATTCTTGAAACAAAGTTAGATAGGAAGTTTCAGCTTGT
                      ____________________________________________________________
consensus TATCAAATTCTTGGTCGATGACATTCTTGAAACAAAGTTAGATAGGAAGTTTCAGCTTGT
 
. : . : . : . : . : . :
rJMSF014O21+ TATGGATAAAGGTACCTTAGATGCCATTGGATTGCATCCTGATGGTCCTATCAAAAGGTG
rJMSF014O22+ TATGGATAAAGGTACCTTAGATGCCATTGGATTGCATCCTGATGGTCCTATCAAAAGGTG
rJMFF016E06+ TATGGATAAAGGTACCTTAGATGCCATTGGATTGCATCCTGATGGTCCTATCAAAAGGTG
rJMSF052G10+ TATGGATAAAGGTACCTTAGATGCCATTGGATTGCATCCTGATGGTCCTATCAAAAGGTG
                      ____________________________________________________________
consensus TATGGATAAAGGTACCTTAGATGCCATTGGATTGCATCCTGATGGTCCTATCAAAAGGTG
 
. : . : . : . : . : . :
rJMSF014O21+ AAGTTCCACCATATAAGACTTGTGCATCTTTGTTTAGTCGTAACCATTTGATTTTCGTGA
rJMSF014O22+ AAGTTCCACCATATAAGACTTGTGCATCTTTGTTTAGTCGTAACCATTTGATTTTCGTGA
rJMFF016E06+ AAGTTCCACCATATAAGACTTGTGCATCTTTGTTTAGTCGTAACCATTTGATTTTCGTGA
rJMSF052G10+ AAGTTCCACCATATAAGACTTGTGCATCTTTGTTTAGTCGTAACCATTTGATTTTCGTGA
                      ____________________________________________________________
consensus AAGTTCCACCATATAAGACTTGTGCATCTTTGTTTAGTCGTAACCATTTGATTTTCGTGA
 
. : . : . : . : . : . :
rJMSF014O21+ AATGCTTCATTTGTTTTTCCAGGATCATGTACTGGGACTCCATCTCAAAACTTGTAGCTC
rJMSF014O22+ AATGCTTCATTTGTTTTTCCAGGATCATGTACTGGGACTCCATCTCAAAACTTGTAGCTC
rJMFF016E06+ AATGCTTCATTTGTTTTTCCAGGATCATGTACTGGGACTCCATCTCAAAACTTGTAGCTC
rJMSF052G10+ AATGCTTCATTTGTTTTTCCAGGATCATGTACTGGGACTCCATCTCAAAACTTGTAGCTC
                      ____________________________________________________________
consensus AATGCTTCATTTGTTTTTCCAGGATCATGTACTGGGACTCCATCTCAAAACTTGTAGCTC
 
. : . : . : . : . : . :
rJMSF014O21+ CTGGTGGGTTATTGGTCATTACATCGTGCAACAGTACGAAGGACGAATTGGTAGAAGAAG
rJMSF014O22+ CTGGTGGGTTATTGGTCATTACATCGTGCAACAGTACGAAGGACGAATTGGTAGAAGAAG
rJMFF016E06+ CTGGTGGGTTATTGGTCATTACATCGTGCAACAGTACGAAGGACGAATTGGTAGAAGAAG
rJMSF052G10+ CTGGTGGGTTATTGGTCATTACATCGTGCAACAGTACGAAGGACGAATTGGTAGAAGAAG
                      ____________________________________________________________
consensus CTGGTGGGTTATTGGTCATTACATCGTGCAACAGTACGAAGGACGAATTGGTAGAAGAAG
 
. : . : . : . : . : . :
rJMSF014O21+ TGTCTGCTTTCAACCTCAACCAAAGAAGAAACCCTGGTAGTCAAGAATCGGAGGGGACTC
rJMSF014O22+ TGTCTGCTTTCAACCTCAACCAAAGAAGAAACCCTGGTAGTCAAGAATCGGAGGGGACTC
rJMFF016E06+ TGTCTGCTTTCAACCTCAACCAAAGAAGAAACCCTGGTAGTCAAGAATCGGAGGGGACTC
rJMSF052G10+ TGTCTGCTTTCAACCTCAACCAAAGAAGAAACCCTGGTAGTCAAGAATCGGAGGGGACTC
                      ____________________________________________________________
consensus TGTCTGCTTTCAACCTCAACCAAAGAAGAAACCCTGGTAGTCAAGAATCGGAGGGGACTC
 
. : . : . : . : . : . :
rJMSF014O21+ AAGAGCAGGAAACCCCCAGAGATCCTCCTCCATTCCGATACCTTGATCATGTTCGATCCT
rJMSF014O22+ AAGAGCAGGAAACCCCCAGAGATCCTCCTCCATTCCGATACCTTGATCATGTTCGATCCT
rJMFF016E06+ AAGAGCAGGAAACCCCCAGAGATCCTCCTCCATTCCGATACCTTGATCATGTTCGATCCT
rJMSF052G10+ AAGAGCAGGAAACCCCCAGAGATCCTCCTCCATTCCGATACCTTGATCATGTTCGATCCT
                      ____________________________________________________________
consensus AAGAGCAGGAAACCCCCAGAGATCCTCCTCCATTCCGATACCTTGATCATGTTCGATCCT
 
. : . : . : . : . : . :
rJMSF014O21+ ATCCAACATTCATGTTTGGAGGATCCGTAGGATCCCGGGTTGCCACAGTCGGCTTCCTAA
rJMSF014O22+ ATCCAACATTCATGTTTGGAGGATCCGTAGGATCCCGGGTTGCCACAGTCGGCTTCCTAA
rJMFF016E06+ ATCCAACATTCATGTTTGGAGGATCCGTAGGATCCCGGGTTGCCACAGTCGGCTTCCTAA
rJMSF052G10+ ATCCAACATTCATGTTTGGAGGATCCGTAGGATCCCGGGTTGCCACAGTCGGCTTCCTAA
                      ____________________________________________________________
consensus ATCCAACATTCATGTTTGGAGGATCCGTAGGATCCCGGGTTGCCACAGTCGGCTTCCTAA
 
. : . : . : . : . : . :
rJMSF014O21+ GGATCTGAATCAATAAAACTTTTTATGTATTCGAGTGAACGTGACTTCTGGTTCTAAGCT
rJMSF014O22+ GGATCTGAATCAATAAAACTTTTTATGTATTCGAGTGAACGTGACTTCTGGTTCTAAGCT
rJMFF016E06+ GGATCTGAATCAATAAAACTTTTTATGTATTCGAGTGAACGTGACTTCTGGTTCTAAGCT
rJMSF052G10+ GGATCTGAATCAATAAAACTTTTTATGTATTCGAGTGAACGTGACTTCTGGTTCTAAGCT
                      ____________________________________________________________
consensus GGATCTGAATCAATAAAACTTTTTATGTATTCGAGTGAACGTGACTTCTGGTTCTAAGCT
 
. : . : . : . : . : . :
rJMSF014O21+ TTTTATGTATGGCCGAATGTTAC
rJMSF014O22+ TTTTATGTATGGCCGAATGT
rJMFF016E06+ TTTTATGTATGGCCGAATGTTACTGTTCAGTATTCTATCTTTCAAAAATTAC
rJMSF052G10+ TTTTATGTATGGCCGAATGTTACTGTTCAGTATTCTATCTTTCAAAAATTACAGGAATTT
                      ____________________________________________________________
consensus TTTTATGTATGGCCGAATGTTACTGTTCAGTATTCTATCTTTCAAAAATTACAGGAATTT
 
. : . : . : . : . : . :
rJMSF052G10+ ATTGGATGCCATCCAGAAGTTCCCTCATTTATGAACGGGGAGTATTTAGTCATGTTATGC
                      ____________________________________________________________
consensus ATTGGATGCCATCCAGAAGTTCCCTCATTTATGAACGGGGAGTATTTAGTCATGTTATGC
 
. : . : . : . : . : . :
rJMSF052G10+ TTATTATGTTGCAAAATGCTGGGGATTTTTGTTTTCTTTTTGTTCTCTCCTCAACACCCT
                      ____________________________________________________________
consensus TTATTATGTTGCAAAATGCTGGGGATTTTTGTTTTCTTTTTGTTCTCTCCTCAACACCCT