Previous Contig 013989:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011A19Sequence222013989 (5)
JMSF043E18Sequence828013989 (5)gb:AB104727_1526539e-121Arabidopsis thaliana At-SPS2 mRNA for solanesyl diphosphate synthase, complete c418013472 (4)gb:AC092781_17357478e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMSF050L01Sequence643013989 (5)gb:AB071514_15228832e-95Arabidopsis thaliana At SPS mRNA for solanesyl diphosphate synthase, complete cd392013472 (4)gb:AC092781_17357478e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMSF052C16Sequence688013989 (5)gb:AB104727_15265396e-29Arabidopsis thaliana At-SPS2 mRNA for solanesyl diphosphate synthase, complete c762013989 (5)gb:AC098573_17367701e-65Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1651_G11, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF011A19- GGCT
                      ____________________________________________________________
consensus GGCT
 
. : . : . : . : . : . :
JMSF011A19- TGGCTTTCATTGAATTGTACAGTAGTTCCCTTCTTCCCCAGCTCTTGTTCCTTTGAAGAA
                      ____________________________________________________________
consensus TGGCTTTCATTGAATTGTACAGTAGTTCCCTTCTTCCCCAGCTCTTGTTCCTTTGAAGAA
 
. : . : . : . : . : . :
JMSF011A19- CGTTCAAATTGGGTAGCTACCGTCGTCCCCGAGTTGGAACTTGCAGTTTTCATCGCCAAA
JMSF052C16- GTTCAAATTGGGTAGCTACCGTCGTCCCCGAGTTGGAACTTGCAGTTTTCATCGCCAAA
                      ____________________________________________________________
consensus CGTTCAAATTGGGTAGCTACCGTCGTCCCCGAGTTGGAACTTGCAGTTTTCATCGCCAAA
 
. : . : . : . : . : . :
JMSF011A19- GGCTTGAGCTTTGCCGCTCTTCTGTGATGGGTTCCCAGAGATTTTGAAACCCAATAAAGA
JMSF052C16- GGCTTGAGCTTTGCCGCTCTTCTGTGATGGGTTCCCAGAGATTTTGAAACCCAATAAAGA
                      ____________________________________________________________
consensus GGCTTGAGCTTTGCCGCTCTTCTGTGATGGGTTCCCAGAGATTTTGAAACCCAATAAAGA
 
. : . : . : . : . : . :
JMSF011A19- TTCCGGTGTGGGTTCTTGATATTCCGGCGGGAGACAAA
JMSF052C16- TTCCGGTGTGGGTTCTTGATATTCCGGCGGGAGACAAAGCCTGGTGTGAGCTTTTAAGGA
                      ____________________________________________________________
consensus TTCCGGTGTGGGTTCTTGATATTCCGGCGGGAGACAAAGCCTGGTGTGAGCTTTTAAGGA
 
. : . : . : . : . : . :
JMSF052C16- ACACTCCTCCGAGGATGATGTCTGCTGCCTACCATAATCTTGAGTTTGGGAGGACGAGGT
                      ____________________________________________________________
consensus ACACTCCTCCGAGGATGATGTCTGCTGCCTACCATAATCTTGAGTTTGGGAGGACGAGGT
 
. : . : . : . : . : . :
JMSF052C16- TGAACTCTGCGGCTTGCGGCTGTTCCTCGTACTCCTCCATTGACAGGCACTCTGCGAACA
                      ____________________________________________________________
consensus TGAACTCTGCGGCTTGCGGCTGTTCCTCGTACTCCTCCATTGACAGGCACTCTGCGAACA
 
. : . : . : . : . : . :
JMSF052C16- AATTTCTGCTCAGAAACGTTAAGAAAGGAGGAGGGTTCAGAGCTCGGAGACTGCTGTGTT
                      ____________________________________________________________
consensus AATTTCTGCTCAGAAACGTTAAGAAAGGAGGAGGGTTCAGAGCTCGGAGACTGCTGTGTT
 
. : . : . : . : . : . :
JMSF052C16- GCCGGCGTGAAATTGGGCGGTGTCATGTGTTCTCCACTAAGGCTCCTGAGAGTTTCCTCA
                      ____________________________________________________________
consensus GCCGGCGTGAAATTGGGCGGTGTCATGTGTTCTCCACTAAGGCTCCTGAGAGTTTCCTCA
 
. : . : . : . : . : . :
JMSF052C16- ATGGAGTCACACCTGCTTCATCATCTCCAATGTTGGATTTGAAGAAAGACAGTGGAAGCC
JMSF043E18+ AAGAAAGACAGTGGAAGCC
                      ____________________________________________________________
consensus ATGGAGTCACACCTGCTTCATCATCTCCAATGTTGGATTTGAAGAAAGACAGTGGAAGCC
 
. : . : . : . : . : . :
JMSF052C16- CTATTTCAGTGGCAAGTTTGTTTGAAGTGGTGACTGATGATCTCCTCACACTGAACAAGA
JMSF043E18+ CTATTTCAGTGGCAAGTTTGTTTGAAGTGGTGACTGATGATCTCCTCACACTGAACAAGA
                      ____________________________________________________________
consensus CTATTTCAGTGGCAAGTTTGTTTGAAGTGGTGACTGATGATCTCCTCACACTGAACAAGA
 
. : . : . : . : . : . :
JMSF052C16- ATTTACAATCTATTGTTGGTGCGGAGAACCCTGTTTTAATGTCTGCCGCTGAGCAGATAT
JMSF043E18+ ATTTACAATCTATTGTTGGTGCGGAGAACCCTGTTTTAATGTCTGCCGCTGAGCAGATAT
                      ____________________________________________________________
consensus ATTTACAATCTATTGTTGGTGCGGAGAACCCTGTTTTAATGTCTGCCGCTGAGCAGATAT
 
. : . : . : . : . : . :
JMSF052C16- TTAGCGCCGGTGGCAAGAGGATGANGCCCGCTTTAGTTTTCCTTGTTTCCCGAGCAACAG
JMSF050L01+ TTCCCGAGCAACAG
JMSF043E18+ TTAGCGCCGGTGGCAAGAGGATGAGGCCCGCTTTAGTTTTCCTTGTTTCCCGAGCAACAG
                      ____________________________________________________________
consensus TTAGCGCCGGTGGCAAGAGGATGAGGCCCGCTTTAGTTTTCCTTGTTTCCCGAGCAACAG
 
. : . : . : . : . : . :
JMSF052C16- CAGAAACTGCTGGTCTAACGGAACTCAC
JMSF050L01+ CAGAAACTGCTGGTCTAACGGAACTCACCAAGGAACACAGGCGGCTGGCTGAAATCATCG
JMSF043E18+ CAGAAACTGCTGGTCTAACGGAACTCACCAAGGAACACAGGCGGCTGGCTGAAATCATCG
                      ____________________________________________________________
consensus CAGAAACTGCTGGTCTAACGGAACTCACCAAGGAACACAGGCGGCTGGCTGAAATCATCG
 
. : . : . : . : . : . :
JMSF050L01+ AAATGATCCACACTGCGAGCCTGATACACGATGACGTGTTGGATGAAAGCGACATGCGAA
JMSF043E18+ AAATGATCCACACTGCGAGCCTGATACACGATGACGTGTTGGATGAAAGCGACATGCGAA
                      ____________________________________________________________
consensus AAATGATCCACACTGCGAGCCTGATACACGATGACGTGTTGGATGAAAGCGACATGCGAA
 
. : . : . : . : . : . :
JMSF050L01+ GAGGAAAGGAAACCGTTCATCAGATATATGGCACGAGGGTAGCGGTGCTTGCTGGGGATT
JMSF043E18+ GAGGAAAGGAAACCGTTCATCAGATATATGGCACGAGGGTAGCGGTGCTTGCTGGGGATT
                      ____________________________________________________________
consensus GAGGAAAGGAAACCGTTCATCAGATATATGGCACGAGGGTAGCGGTGCTTGCTGGGGATT
 
. : . : . : . : . : . :
JMSF050L01+ TTATGTTTGCGCAATCTTCATGGTACCTAGCTAACCTCGAAAACATTGAAGTCATAAAGC
JMSF043E18+ TTATGTTTGCGCAATCTTCATGGTACCTAGCTAACCTCGAAAACATTGAAGTCATAAAGC
rJMSF052C16+ CATGGTACCTAGCTAACCTNGAAAACATTGAAGTCATAAAGC
                      ____________________________________________________________
consensus TTATGTTTGCGCAATCTTCATGGTACCTAGCTAACCTCGAAAACATTGAAGTCATAAAGC
 
. : . : . : . : . : . :
JMSF050L01+ TCATAAGTCAGGTCATAAAAGACTTTGCTAGTGGCGAAATAAAGCAGGCGTCGAGTTTAT
JMSF043E18+ TCATAAGTCAGGTCATAAAAGACTTTGCTAGTGGCGAAATAAAGCAGGCGTCGAGTTTAT
rJMSF052C16+ TCATAAGTCAGGTCATNAAAGACTTTGCTAGTGGCGAAATAAAGCAGGCGTCGAGTTTAT
                      ____________________________________________________________
consensus TCATAAGTCAGGTCATAAAAGACTTTGCTAGTGGCGAAATAAAGCAGGCGTCGAGTTTAT
 
. : . : . : . : . : . :
JMSF050L01+ TCGACTGTGATGTCGGGATGGAGGATTACTTAATCAAGAGCTACTACAAAACGGCCTCGT
JMSF043E18+ TCGACTGTGATGTCGGGATGGAGGATTACTTAATCAAGAGCTACTACAAAACGGCCTCGT
rJMSF052C16+ TCGACTGTGATGTCGGGATGGAGGATTACTTAATCAAGAGNTACTNCAAAACGGCCTCGT
                      ____________________________________________________________
consensus TCGACTGTGATGTCGGGATGGAGGATTACTTAATCAAGAGCTACTACAAAACGGCCTCGT
 
. : . : . : . : . : . :
JMSF050L01+ TGATCGCTGCAAGCACCAAGGGGGCCGCCATTTTCAGCGGGGTCGACAGCGGGATCAGTG
JMSF043E18+ TGATCGCTGCAAGCACCAAGGGGGCCGCCATTTTCAGCGGGGTCGACAGCGGGATCAGTG
rJMSF052C16+ TGATNGCTGCAAGCACCAAGGGGGCCGCCNTTTTCAGCGGGGTNGACAGCGGGATCAGTG
                      ____________________________________________________________
consensus TGATCGCTGCAAGCACCAAGGGGGCCGCCATTTTCAGCGGGGTCGACAGCGGGATCAGTG
 
. : . : . : . : . : . :
JMSF050L01+ AGCAGATGTATCAATACGGGAGGAACCTCGGTCTATCGTTCCAGATCGTGGACGACATTC
JMSF043E18+ AGCAGATGTATCAATACGGGAGGAACCTCGGTCTATCGTTCCAGATCGTGGACGACATTC
rJMSF052C16+ AGCAGATGTATCAATACGGGAGGAACCTCGGTCTATCGTTCCAGATCGTGGNCGACATTN
                      ____________________________________________________________
consensus AGCAGATGTATCAATACGGGAGGAACCTCGGTCTATCGTTCCAGATCGTGGACGACATTC
 
. : . : . : . : . : . :
JMSF050L01+ TCGACTTCACTCAATCGGCCGAGCAGCTTGGGAAGCCAGCCGGGAGCGACCTGGCGAAGG
JMSF043E18+ TCGACTTCACTCAATCGGCCGAGCAGCTTGGGAAGCCAGCCGGGAGCGACCTGGCGAAGG
rJMSF052C16+ TTGACTTCACTCAATCGGCCGAGCAGCTTGGGAAGCCAGCCGGGAGCGACCTGGCGAAGG
                      ____________________________________________________________
consensus TCGACTTCACTCAATCGGCCGAGCAGCTTGGGAAGCCAGCCGGGAGCGACCTGGCGAAGG
 
. : . : . : . : . : . :
JMSF050L01+ GCAACCTGACAGCGCCGGTGATATTCGCGCTGGAAACCGAGCCGAAACTGAGGGACATAA
JMSF043E18+ GCAACCTGACAGCGCCGGTGATATTCGCGCTGGAAACCGAGCCGAAACTGAGGGACATAA
rJMSF052C16+ GCAACCTGACAGCGCCGGTGATATTCGCGCTGGAAACCGAGCCGAAACTGAGGGACATAA
                      ____________________________________________________________
consensus GCAACCTGACAGCGCCGGTGATATTCGCGCTGGAAACCGAGCCGAAACTGAGGGACATAA
 
. : . : . : . : . : . :
JMSF050L01+ TCGAATCCGAATTCTGCGAGGCGGGCGCT
JMSF043E18+ TCGAATCCGAATTCTGCGAGGCGGGCGCT
rJMSF052C16+ TNGAATNCGAATTTTGCGAGGCGGGCGCTCTCGAGGAAGCCNTTGGCATNGTGAAGAGGT
                      ____________________________________________________________
consensus TCGAATCCGAATTCTGCGAGGCGGGCGCTCTCGAGGAAGCCNTTGGCATNGTGAAGAGGT
 
. : . : . : . : . : . :
rJMSF052C16+ GCGGGGGCATCGCGAGAGCCGAGGAGCTGGCGAAAGAGAAAGCTGATATNGCAATTCAGA
                      ____________________________________________________________
consensus GCGGGGGCATCGCGAGAGCCGAGGAGCTGGCGAAAGAGAAAGCTGATATNGCAATTCAGA
 
. : . : . : . : . : . :
rJMSF052C16+ ACCTCGAGTGCTTGCCCCCCAGCCCTTTCCGGGTCGCTNTCGAGGAAATGGTGCAGTATA
                      ____________________________________________________________
consensus ACCTCGAGTGCTTGCCCCCCAGCCCTTTCCGGGTCGCTNTCGAGGAAATGGTGCAGTATA
 
. : . : . : . : . : . :
rJMSF052C16+ ATCTTGAAAGAGTTAAGTNGAATTGAAGAAGAAGAAGAAGAAGAACNCNGAATTTGGATC
                      ____________________________________________________________
consensus ATCTTGAAAGAGTTAAGTNGAATTGAAGAAGAAGAAGAAGAAGAACNCNGAATTTGGATC
 
. : . : . : . : . : . :
rJMSF052C16+ AAAGCNCAGCTNTCTCAGCTACNCTGTTCTTGTAAAACNTTCAGTTTTACCCTTGCATAT
                      ____________________________________________________________
consensus AAAGCNCAGCTNTCTCAGCTACNCTGTTCTTGTAAAACNTTCAGTTTTACCCTTGCATAT
 
. : . : . : . : . : . :
rJMSF052C16+ AGTAGTGCCNTTGATTTTCAGTGTTTGTATACTCATAAAAGCCCNGAAGCAATGACTTTT
                      ____________________________________________________________
consensus AGTAGTGCCNTTGATTTTCAGTGTTTGTATACTCATAAAAGCCCNGAAGCAATGACTTTT