Previous Contig 013988:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019N17Sequence409013988 (4)gb:AY102556_15777852e-20Arabidopsis thaliana hypothetical protein (At2g28690/T8O18.2) mRNA, complete cds749013988 (4)gb:AY102556_15777855e-28Arabidopsis thaliana hypothetical protein (At2g28690/T8O18.2) mRNA, complete cds
JMSF052C14Sequence639013988 (4)gb:AY102556_15777854e-20Arabidopsis thaliana hypothetical protein (At2g28690/T8O18.2) mRNA, complete cds1046013988 (4)gb:AY102556_15777857e-37Arabidopsis thaliana hypothetical protein (At2g28690/T8O18.2) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052C14- GAATTGCATGTACTGTATTGGTTGAGTTTTCTTTTTTTTAAT
                      ____________________________________________________________
consensus GAATTGCATGTACTGTATTGGTTGAGTTTTCTTTTTTTTAAT
 
. : . : . : . : . : . :
JMSF052C14- GTTTCATGTTTGTTTGTTTTCTGTAAAAGATTGGCCAGTTCTTGAATTCTGATGAATTTA
                      ____________________________________________________________
consensus GTTTCATGTTTGTTTGTTTTCTGTAAAAGATTGGCCAGTTCTTGAATTCTGATGAATTTA
 
. : . : . : . : . : . :
JMSF052C14- CAGACAATGGATGAACTGAAGCAGAATCTACGTTAATTGAGTTTGCTTTTTTGAATGTTT
                      ____________________________________________________________
consensus CAGACAATGGATGAACTGAAGCAGAATCTACGTTAATTGAGTTTGCTTTTTTGAATGTTT
 
. : . : . : . : . : . :
JMSF052C14- TGCAGTTTTGTTTGTTTTTCTGTAAAAGATTGTTCAGTTGTTGAAATTGTGATGAATTTG
                      ____________________________________________________________
consensus TGCAGTTTTGTTTGTTTTTCTGTAAAAGATTGTTCAGTTGTTGAAATTGTGATGAATTTG
 
. : . : . : . : . : . :
JMSF019N17- ACAATGGATGAACTGAAGCAG-AAGC-TTTTGTATAGTACGTTTGAACTGGAAAGGT
JMSF052C14- CAGACAATGGATGAACTGAAGCAG-AAGC-TTTTGTATAGTACGTTTGAACTGGAAAGGT
rJMSF052C14+ ACAATGGATGAACTGAAGCAGAAAGCTTTTTGTATAGTACGTTTGAACTGGAAAGGT
                      ____________________________________________________________
consensus CAGACAATGGATGAACTGAAGCAG-AAGC-TTTTGTATAGTACGTTTGAACTGGAAAGGT
 
. : . : . : . : . : . :
JMSF019N17- TTAAGGCGGAATCGAGTGAGGAGACGAGGAAGAGCAAAGAATATGTGAAGCAACTGGTTC
JMSF052C14- TTAAGGCGGAATCGAGTGAGGAGACGAGGAAGAGCAAAGAATATGTGAAGCAACTGGTTC
rJMSF052C14+ TTAAGGCGGAATCGAGTGAGGAGACGAGGAAGAGCAAAGAATATGTGAAGCAACTGGTTC
                      ____________________________________________________________
consensus TTAAGGCGGAATCGAGTGAGGAGACGAGGAAGAGCAAAGAATATGTGAAGCAACTGGTTC
 
. : . : . : . : . : . :
JMSF019N17- AGCTTCTGAAGGTTGCTTGTAAGGAGAGAGATGCAGCAAGAGATCAGCTTCAGAAGCTGC
JMSF052C14- AGCTTCTGAAGGTTGCTTGTAAGGAGAGAGATGCAGCAAGAGATCAGCTTCAGAAGCTGC
rJMSF019N17+ TCTGAAGGTTGCTTGTAAGGAGAGAGATGCAGCAAGAGATCAGCTTCAGAAGCTGC
rJMSF052C14+ AGCTTCTGAAGGTTGCTTGTAAGGAGAGAGATGCAGCAAGAGATCAGCTTCAGAAGCTGC
                      ____________________________________________________________
consensus AGCTTCTGAAGGTTGCTTGTAAGGAGAGAGATGCAGCAAGAGATCAGCTTCAGAAGCTGC
 
. : . : . : . : . : . :
JMSF019N17- TGGGAACAGGAAGTGTTGTTCTGTTGCCTGCAACGAAGGCGAATTCGGGTGTTACTGAAT
JMSF052C14- TGGGAACAGGAAGTGTTGTTCTGTTGCCTGCAACGAAGGCGAATTCGGGTGTTACTGAAT
rJMSF019N17+ TGGGAACAGGAAGTGTTGTTCTGTTGCCTGCAACGAAGGCGAATTCGGGTGTTACTGAAT
rJMSF052C14+ TGGGAACAGGAAGTGTTGTTCTGTTGCCTGCAACGAAGGCGAATTCGGGTGTTACTGAAT
                      ____________________________________________________________
consensus TGGGAACAGGAAGTGTTGTTCTGTTGCCTGCAACGAAGGCGAATTCGGGTGTTACTGAAT
 
. : . : . : . : . : . :
JMSF019N17- CGAACAGCCTGTCCGAGA
JMSF052C14- CGAACAGCCTGTCCGAGACCTACAACACTCAGGGCTCATCCCCCGTCGAGTCCTTTCTCG
rJMSF019N17+ CGAACAGCCTGTCCGAGACCTACAACACTCAGGGCTCATCCCCCGTCGAGTCCTTTCTCG
rJMSF052C14+ CGAACAGCCTGTCCGAGACCTACAACACTCAGGGCTCATCCCCCGTCGAGTCCTTTCTCG
                      ____________________________________________________________
consensus CGAACAGCCTGTCCGAGACCTACAACACTCAGGGCTCATCCCCCGTCGAGTCCTTTCTCG
 
. : . : . : . : . : . :
JMSF052C14- AGGCAGTTTCATCCCCCGAGCTCTTGAATAGCAGTGCAGTTGATTCTAGTGCCATGGTTC
rJMSF019N17+ AGGCAGTTTCATCCCCCGAGCTCTTGAATAGCAGTGCAGTTGATTCTAGTGCCATGGTTC
rJMSF052C14+ AGGCAGTTTCATCCCCCGAGCTCTTGAATAGCAGTGCAGTTGATTCTAGTGCCATGGTTC
                      ____________________________________________________________
consensus AGGCAGTTTCATCCCCCGAGCTCTTGAATAGCAGTGCAGTTGATTCTAGTGCCATGGTTC
 
. : . : . : . : . : . :
JMSF052C14- AGAACAGCCTGGTTTCTGCCCCGGTGGATCTGGCAGGGATGGCGATTGAGGGTCTCGCG
rJMSF019N17+ AGAACAGCCTGGTTTCTGCCCCGGTGGATCTGGCAGGGATGGCGATTGAGGGTCTCGCGA
rJMSF052C14+ AGAACAGCCTGGTTTCTGCCCCGGTGGATCTGGCAGGGATGGCGATTGAGGGTCTCGCGA
                      ____________________________________________________________
consensus AGAACAGCCTGGTTTCTGCCCCGGTGGATCTGGCAGGGATGGCGATTGAGGGTCTCGCGA
 
. : . : . : . : . : . :
rJMSF019N17+ AGGGGAAATGTTTGCCTCAGAAGGGGAAGCTTCTGCAGGCCGTGCTCGAGGCGGGGCCGC
rJMSF052C14+ AGGGGAAATGTTTGCCTCAGAAGGGGAAGCTTCTGCAGGCCGTGCTCGAGGCGGGGCCGC
                      ____________________________________________________________
consensus AGGGGAAATGTTTGCCTCAGAAGGGGAAGCTTCTGCAGGCCGTGCTCGAGGCGGGGCCGC
 
. : . : . : . : . : . :
rJMSF019N17+ TTCTGCAGACGCTGCTCGTGGCGGGGCCGCTCCCCAGGTGGCGCAACCCGCCTCAGCTGA
rJMSF052C14+ TTCTGCAGACGCTGCTCGTGGCGGGGCCGCTCCCCAGGTGGCGCAACCCGCCTCAGCTGA
                      ____________________________________________________________
consensus TTCTGCAGACGCTGCTCGTGGCGGGGCCGCTCCCCAGGTGGCGCAACCCGCCTCAGCTGA
 
. : . : . : . : . : . :
rJMSF019N17+ AGGCCTTCCATATCCCACCGGTTTCCATCAGGGGCTGCAATGATGCTGAGATTTTTGCTC
rJMSF052C14+ AGGCCTTCCATATCCCACCGGTTTCCATCAGGGGCTGCAATGATGCTGAGATTTTTGCTC
                      ____________________________________________________________
consensus AGGCCTTCCATATCCCACCGGTTTCCATCAGGGGCTGCAATGATGCTGAGATTTTTGCTC
 
. : . : . : . : . : . :
rJMSF019N17+ ATCACAGCCCTGCTGTTGCGGCTTCATCAAGAACACTTTCACAGCTTTGCTTCGAGATTC
rJMSF052C14+ ATCACAGCCCTGCTGTTGCGGCTTCATCAAGAACACTTTCACAGCTTTGCTTCGAGATTC
                      ____________________________________________________________
consensus ATCACAGCCCTGCTGTTGCGGCTTCATCAAGAACACTTTCACAGCTTTGCTTCGAGATTC
 
. : . : . : . : . : . :
rJMSF019N17+ CTGGCCCGTCTCCACAAATGTTGTCAATGCCTATGTTGAACTTTGGATCCTGTCTTGGCA
rJMSF052C14+ CTGGCCCGTCTCCACAAATGTTGTCAATGCCTATGTTGAACTTTGGATCCTGTCTTGGCA
                      ____________________________________________________________
consensus CTGGCCCGTCTCCACAAATGTTGTCAATGCCTATGTTGAACTTTGGATCCTGTCTTGGCA
 
. : . : . : . : . : . :
rJMSF019N17+ GCCAGAGGTTGATGTCTGGTGGCTCAAACATGGCTAGCAGTTATACCCATCTCGAAAAGC
rJMSF052C14+ GCCAGAGGTTGATGTCTGGTGGCTCAAACATGGCTAGCAGTTATACCCATCTCGAAAAGC
                      ____________________________________________________________
consensus GCCAGAGGTTGATGTCTGGTGGCTCAAACATGGCTAGCAGTTATACCCATCTCGAAAAGC
 
. : . : . : . : . : . :
rJMSF019N17+ GACAAAGGTTGCTGTGAAGAACTCAAAGCATTTTTGTACAAAGACAATATTTGGGTGGGG
rJMSF052C14+ GACAAAGGTTGCTGTGAAGAACTCAAAGCATTTTTGTACAAAGACAATATTTGGGTGGGG
                      ____________________________________________________________
consensus GACAAAGGTTGCTGTGAAGAACTCAAAGCATTTTTGTACAAAGACAATATTTGGGTGGGG
 
. : . : . : . : . : . :
rJMSF019N17+ ATGTAAATGGGATTATGGGGTAGATACATACAT
rJMSF052C14+ ATGTAAATGGGATTATGGGGTAGATACATACATTTCATTTTTAAACTCAATTCTTCCTTC
                      ____________________________________________________________
consensus ATGTAAATGGGATTATGGGGTAGATACATACATTTCATTTTTAAACTCAATTCTTCCTTC