Previous Contig 013984:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022I06Sequence481013984 (3)pir|D86196|D861964e-32hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889628 Arabid720010320 (5)pir|D86196|D861961e-51hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889628 Arabid
JMFF043I12Sequence633013984 (3)pir|D86196|D861963e-45hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889628 Arabid649010320 (5)pir|D86196|D861967e-35hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889628 Arabid
JMSF052B18Sequence549013984 (3)pir|D86196|D861962e-14hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889628 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043I12+ TCAAGCCCAACAAGTTCATAGGTTCATTNTCAGTG
                      ____________________________________________________________
consensus TCAAGCCCAACAAGTTCATAGGTTCATTNTCAGTG
 
. : . : . : . : . : . :
JMFF043I12+ AGCTTCCCAGTGAACTCATCATCACTCAGTTCTTGACCATCACAAAACCGGTATAGAACC
                      ____________________________________________________________
consensus AGCTTCCCAGTGAACTCATCATCACTCAGTTCTTGACCATCACAAAACCGGTATAGAACC
 
. : . : . : . : . : . :
JMFF043I12+ CTAGTGGGAAGAGGCAATTTTACTTTTAAACACTCCTCCAAGTAATTTATTTGATCCTCG
                      ____________________________________________________________
consensus CTAGTGGGAAGAGGCAATTTTACTTTTAAACACTCCTCCAAGTAATTTATTTGATCCTCG
 
. : . : . : . : . : . :
JMFF043I12+ GAAGCACCTTTGCGTAAGGTAGGCAAAACCCCAGGGAAGTTAATCTCCATCCAGCTTCTA
                      ____________________________________________________________
consensus GAAGCACCTTTGCGTAAGGTAGGCAAAACCCCAGGGAAGTTAATCTCCATCCAGCTTCTA
 
. : . : . : . : . : . :
JMFF043I12+ ATTCTGCTCCAACATCTTTTGGCTCTTATAACCAAGGTCCATGGATACATATTGAATGCT
                      ____________________________________________________________
consensus ATTCTGCTCCAACATCTTTTGGCTCTTATAACCAAGGTCCATGGATACATATTGAATGCT
 
. : . : . : . : . : . :
JMFF043I12+ TCCCTCCATGTTTGATAAGATACCCTGAAAGAGGGAGTGGGGTTTCCCCAAGGGTCCTGA
JMFF022I06+ TACCCTGAAAGAGGGAGTGGGGTTTCCCCAAGGGTCCTGA
rJMSF052B18- TACCCTGAAAGAGGGAGTGGGGTTTCCCCAAGGGTCCTGA
                      ____________________________________________________________
consensus TCCCTCCATGTTTGATAAGATACCCTGAAAGAGGGAGTGGGGTTTCCCCAAGGGTCCTGA
 
. : . : . : . : . : . :
JMFF043I12+ GGAGAAGACAAGCCGAGTTCATCGGCGCAGAATTTGGACCAGAGGGAATCGTCGTCGGAT
JMFF022I06+ GGAGAAGACAAGCCGAGTTCATCGGCGCAGAATTTGGACCAGAGGGAATCGTCGTCGGAT
rJMSF052B18- GGAGAAGACAAGCCGAGTTCATCGGCGCAGAATTTGGACCAGAGGGAATCGTCGTCGGAT
                      ____________________________________________________________
consensus GGAGAAGACAAGCCGAGTTCATCGGCGCAGAATTTGGACCAGAGGGAATCGTCGTCGGAT
 
. : . : . : . : . : . :
JMFF043I12+ ACCCAATCCCTAAATCTCCGGCTGATGCAGGCCGTAGCGGCTACGTCTTCCGGCATGAGT
JMFF022I06+ ACCCAATCCCTAAATCTCCGGCTGATGCAGGCCGTAGCGGCTACGTCTTCCGGCATGAGT
rJMSF052B18- ACCCAATCCCTAAATCTCCGGCTGATGCAGGCCGTAGCGGCTACGTCTTCCGGCATGAGT
                      ____________________________________________________________
consensus ACCCAATCCCTAAATCTCCGGCTGATGCAGGCCGTAGCGGCTACGTCTTCCGGCATGAGT
 
. : . : . : . : . : . :
JMFF043I12+ TTCGATAGAATGATGTGAATCGCAAGCCCACCCACGCTCTCCAATCCCATCATTTCTTCT
JMFF022I06+ TTCGATAGAATGATGTGAATCGCAAGCCCACCCACGCTCTCCAATCCCATCATTTCTTCT
rJMSF052B18- TTCGATAGAATGATGTGAATCGCAAGCCCACCCACGCTCTCCAATCCCATCATTTCTTCT
                      ____________________________________________________________
consensus TTCGATAGAATGATGTGAATCGCAAGCCCACCCACGCTCTCCAATCCCATCATTTCTTCT
 
. : . : . : . : . : . :
JMFF043I12+ TCTTCTTCTTCTTCCTCTATCGCCGACGGAAAACAGGAAGAGTGATGATCAGGTAAGTGA
JMFF022I06+ TCTTCTTCTTCTTCCTCTATCGCCGACGGAAAACAGGAAGAGTGATGATCAGGTAAGTGA
rJMSF052B18- TCTTCTTCTTCTTCCTCTATCGCCGACGGAAAACAGGAAGAGTGATGATCAGGTAAGTGA
                      ____________________________________________________________
consensus TCTTCTTCTTCTTCCTCTATCGCCGACGGAAAACAGGAAGAGTGATGATCAGGTAAGTGA
 
. : . : . : . : . : . :
JMFF043I12+ AGACGACTGTTGAAGAGAGCGTCTGAAAAAGGATCGTTATTAAGAAATTCAGCTAATC
JMFF022I06+ AGACGACTGTTGAAGAGAGCGTCTGAAAAAGGATCGTTATTAAGAAATTCAGCTAATC
rJMSF052B18- AGACGACTGTTGAAGAGAGCGTCTGAAAAAGGATCGTTATTAAGAAATTCAGCTAATCCA
                      ____________________________________________________________
consensus AGACGACTGTTGAAGAGAGCGTCTGAAAAAGGATCGTTATTAAGAAATTCAGCTAATCCA