Previous Contig 013981:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010G23Sequence267008088 (3)706013981 (3)gb:AY070379_15667791e-64Arabidopsis thaliana unknown protein (At5g11010) mRNA, complete cds.>gb:AY096562
JMSF023J20Sequence610008088 (3)gb:AF412075_17973283e-25Arabidopsis thaliana AT5g11010/T30N20_280 mRNA, complete cds.746013981 (3)gb:AY070379_15667794e-66Arabidopsis thaliana unknown protein (At5g11010) mRNA, complete cds.>gb:AY096562
JMSF052A18Sequence656008088 (3)gb:AF412075_17973281e-33Arabidopsis thaliana AT5g11010/T30N20_280 mRNA, complete cds.926013981 (3)gb:AY070379_15667792e-86Arabidopsis thaliana unknown protein (At5g11010) mRNA, complete cds.>gb:AY096562

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052A18+ TCAAAAAGGGACCCAAAACTCTACTT
                      ____________________________________________________________
consensus TCAAAAAGGGACCCAAAACTCTACTT
 
. : . : . : . : . : . :
rJMSF052A18+ AACATATGCATGTGCCTTGTATGATCATTATAAGAAAAAGTACTACATGCTTAATAATAG
                      ____________________________________________________________
consensus AACATATGCATGTGCCTTGTATGATCATTATAAGAAAAAGTACTACATGCTTAATAATAG
 
. : . : . : . : . : . :
rJMSF052A18+ TGAAAAGCCTGCTAATGCAGAAATGCCCATTGTGATTAATACCCCTGGCTGGGTAAAAGG
                      ____________________________________________________________
consensus TGAAAAGCCTGCTAATGCAGAAATGCCCATTGTGATTAATACCCCTGGCTGGGTAAAAGG
 
. : . : . : . : . : . :
rJMSF010G23+ CTCCTAGTCATGTTGTCAA
rJMSF023J20+ AAATATANTTCTCCTAGTCATGTTGTCAA
rJMSF052A18+ CATTGGCTATGAAATACTTGTGGATATCTTGAAATATATTTCTCCTAGTCATGTTGTCAA
                      ____________________________________________________________
consensus CATTGGCTATGAAATACTTGTGGATATCTTGAAATATATTTCTCCTAGTCATGTTGTCAA
 
. : . : . : . : . : . :
rJMSF010G23+ GATTCGCATATCTGCTGAGAGCAAGAATCTACCACCGGGGGCATTTTGGCTAGATGAAGG
rJMSF023J20+ GATTCGCATATCTGCTGAGAGCAAGAATCTACCACCGGGGGCATTTTGGCTAGATGAAGG
rJMSF052A18+ GATTCGCATATCTGCTGAGAGCAAGAATCTACCACCGGGGGCATTTTGGCTAGATGAAGG
                      ____________________________________________________________
consensus GATTCGCATATCTGCTGAGAGCAAGAATCTACCACCGGGGGCATTTTGGCTAGATGAAGG
 
. : . : . : . : . : . :
rJMSF010G23+ GGAAGCTCCAGTGACAAACCTAATTGAAATCAATTCAGCCCGTCAGGACTCTTCACGAAG
rJMSF023J20+ GGAAGCTCCAGTGACAAACCTAATTGAAATCAATTCAGCCCGTCAGGACTCTTCACGAAG
rJMSF052A18+ GGAAGCTCCAGTGACAAACCTAATTGAAATCAATTCAGCCCGTCAGGACTCTTCACGAAG
                      ____________________________________________________________
consensus GGAAGCTCCAGTGACAAACCTAATTGAAATCAATTCAGCCCGTCAGGACTCTTCACGAAG
 
. : . : . : . : . : . :
rJMSF010G23+ ATCGATTCTGGTGCAGAAGGATGCACGACTTCTGAGGGACCTTCGTATCATAGCTTATTT
rJMSF023J20+ ATCGATTCTGGTGCAGAAGGATGCACGACTTCTGAGGGACCTTCGTATCATAGCTTATTT
rJMSF052A18+ ATCGATTCTGGTGCAGAAGGATGCACGACTTCTGAGGGACCTTCGTATCATAGCTTATTT
                      ____________________________________________________________
consensus ATCGATTCTGGTGCAGAAGGATGCACGACTTCTGAGGGACCTTCGTATCATAGCTTATTT
 
. : . : . : . : . : . :
rJMSF010G23+ TAGACAATGTTTTCCAAATGATGCTAATATCACTACATCCAAGGAACTAGCTCATGCATT
rJMSF023J20+ TAGACAATGTTTTCCAAATGATGCTAATATCACTACATCCAAGGAACTAGCTCATGCATT
rJMSF052A18+ TAGACAATGTTTTCCAAATGATGCTAATATCACTACATCCAAGGAACTAGCTCATGCATT
                      ____________________________________________________________
consensus TAGACAATGTTTTCCAAATGATGCTAATATCACTACATCCAAGGAACTAGCTCATGCATT
 
. : . : . : . : . : . :
rJMSF010G23+ AGCTGCACATCCTCCATATGAGATATCTATATCAAGTGTCAAAATTAAGCACCTTCACTG
rJMSF023J20+ AGCTGCACATCCTCCATATGAGATATCTATATCAAGTGTCAAAATTAAGCACCTTCACTG
rJMSF052A18+ AGCTGCACATCCTCCATATGAGATATCTATATCAAGTGTCAAAATTAAGCACCTTCACTG
                      ____________________________________________________________
consensus AGCTGCACATCCTCCATATGAGATATCTATATCAAGTGTCAAAATTAAGCACCTTCACTG
 
. : . : . : . : . : . :
rJMSF010G23+ CCAGGTACCCAAGGATGAGGTTTTCTACAGCTTGAATGCAACAATTGTTGGCTTGGCCGT
rJMSF023J20+ CCAGGTACCCAAGGATGAGGTTTTCTACAGCTTGAATGCAACAATTGTTGGCTTGGCCGT
rJMSF052A18+ CCAGGTACCCAAGGATGAGGTTTTCTACAGCTTGAATGCAACAATTGTTGGCTTGGCCGT
                      ____________________________________________________________
consensus CCAGGTACCCAAGGATGAGGTTTTCTACAGCTTGAATGCAACAATTGTTGGCTTGGCCGT
 
. : . : . : . : . : . :
rJMSF010G23+ TAGCCCTGAAGATATGCCTCACTGTGTTGGTTTAGGAATTGTGAGAGGCATTGACACCAC
rJMSF023J20+ TAGCCCTGAAGATATGCCTCACTGTGTTGGTTTAGGAATTGTGAGAGGCATTGACACCAC
rJMSF052A18+ TAGCCCTGAAGATATGCCTCACTGTGTTGGTTTAGGAATTGTGAGAGGCATTGACACCAC
                      ____________________________________________________________
consensus TAGCCCTGAAGATATGCCTCACTGTGTTGGTTTAGGAATTGTGAGAGGCATTGACACCAC
 
. : . : . : . : . : . :
rJMSF010G23+ CAGGCAGGTCATCTATTTAATTACTCCTGTGCCATTGGACAGTCTGGAAAAGGTTGATCT
rJMSF023J20+ CAGGCAGGTCATCTATTTAATTACTCCTGTGCCATTGGACAGTCTGGAAAAGGTTGATCT
rJMSF052A18+ CAGGCAGGTCATCTATTTAATTACTCCTGTGCCATTGGACAGTCTGGAAAAGGTTGATCT
                      ____________________________________________________________
consensus CAGGCAGGTCATCTATTTAATTACTCCTGTGCCATTGGACAGTCTGGAAAAGGTTGATCT
 
. : . : . : . : . : . :
rJMSF010G23+ TTTGCTGCAGGGTTTTATTGAAATTCCTACTTCTTTATTGCAAGTTCAAGGCTGCATTTC
rJMSF023J20+ TTTGCTGCAGGGTTTTATTGAAATTCCTACTTCTTTATTGCAAGTTCAAGGCTGCATTTC
rJMSF052A18+ TTTGCTGCAGGGTTTTATTGAAATTCCTACTTCTTTATTGCAAGTTCAAGGCTGCATTTC
                      ____________________________________________________________
consensus TTTGCTGCAGGGTTTTATTGAAATTCCTACTTCTTTATTGCAAGTTCAAGGCTGCATTTC
 
. : . : . : . : . : . :
rJMSF010G23+ ACCTTACATGTCTGCCAATGTATTGCCTGCATATTAGGAGACCAATAGTGGTGCTTGTTA
rJMSF023J20+ ACCTTACATGTCTGCCAATGTATTGCCTGCATATTAGGAGACCAATAGTGGTGCTTGTTA
rJMSF052A18+ ACCTTACATGTCTGCCAATGTATTGCCTGCATATTAGGAGACCAATAGTGGTGCTTGTTA
                      ____________________________________________________________
consensus ACCTTACATGTCTGCCAATGTATTGCCTGCATATTAGGAGACCAATAGTGGTGCTTGTTA
 
. : . : . : . : . : . :
rJMSF010G23+ GAATTAGATTATTAGTTAAGTAGTAGTTTGCAAAATTAAATTACTGAGGTTAGATATCCT
rJMSF023J20+ GAATTAGATTATTAGTTAAGTAGTAGTTTGCAAAATTAAATTACTGAGGTTAGATATCCT
rJMSF052A18+ GAATTAGATTATTAGTTAAGTAGTAGTTTGCAAAATTAAATTACTGAGGTTAGATATCCT
                      ____________________________________________________________
consensus GAATTAGATTATTAGTTAAGTAGTAGTTTGCAAAATTAAATTACTGAGGTTAGATATCCT
 
. : . : . : . : . : . :
rJMSF010G23+ CTTAATAGGAATTCTAATATATCGAAC
rJMSF023J20+ CTTAATAGGAATTCTAATATATCGAACAACAAATGTACTGTCAGACGATGAAGTGTT
rJMSF052A18+ CTTAATAGGAATTCTAATATATCGAACAACAAATGTACTGTCAGACGATGAAGTGTTGAT
                      ____________________________________________________________
consensus CTTAATAGGAATTCTAATATATCGAACAACAAATGTACTGTCAGACGATGAAGTGTTGAT