Previous Contig 013976:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF051P17Sequence661013976 (2)pir|E84499|E844997e-64hypothetical protein At2g11890 [imported] - Arabidopsis thaliana>gb:AC007045_153703013976 (2)pir|E84499|E844997e-49hypothetical protein At2g11890 [imported] - Arabidopsis thaliana>gb:AC007045_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051P17- GGCTGCATTTTGTAAAGATGGAGATTGAAGTCAAGCTCCGA
                      ____________________________________________________________
consensus GGCTGCATTTTGTAAAGATGGAGATTGAAGTCAAGCTCCGA
 
. : . : . : . : . : . :
JMSF051P17- TTGCCTGATGCCGATTCGCACCGAAAGCTCCTCTCGCTTCTCACTCCGTTTCACATCCAA
                      ____________________________________________________________
consensus TTGCCTGATGCCGATTCGCACCGAAAGCTCCTCTCGCTTCTCACTCCGTTTCACATCCAA
 
. : . : . : . : . : . :
JMSF051P17- ACCCACCACCAACGCAACACCTTCTTCGACGGCGCGGCGGCGGAGCTCAGCTCTCAGCGT
                      ____________________________________________________________
consensus ACCCACCACCAACGCAACACCTTCTTCGACGGCGCGGCGGCGGAGCTCAGCTCTCAGCGT
 
. : . : . : . : . : . :
JMSF051P17- GCCGTTCTCCGCCTCCGGTTCTACGAGAACTCGGAATCCCCCAAGTGTGTCGTCTCCCTC
rJMSF051P17+ GTTCTACGAGAACTCGGAATCCCCCAAGTGTGTCGTCTCCCTC
                      ____________________________________________________________
consensus GCCGTTCTCCGCCTCCGGTTCTACGAGAACTCGGAATCCCCCAAGTGTGTCGTCTCCCTC
 
. : . : . : . : . : . :
JMSF051P17- AAGGCAAAAGCGGTACTAGTCAACGGCGTGAGTAGAGTCGAGGAGGATGAGGAGGAACTG
rJMSF051P17+ AAGGCAAAAGCGGTACTAGTCAACGGCGTGAGTAGAGTCGAGGAGGATGAGGAGGAACTG
                      ____________________________________________________________
consensus AAGGCAAAAGCGGTACTAGTCAACGGCGTGAGTAGAGTCGAGGAGGATGAGGAGGAACTG
 
. : . : . : . : . : . :
JMSF051P17- GACCCCAAAATCGGGTACGAGTGCGTTGAGAATCCGGCGAAGTTAATTGAGGTGGATTCG
rJMSF051P17+ GACCCCAAAATCGGGTACGAGTGCGTTGAGAATCCGGCGAAGTTAATTGAGGTGGATTCG
                      ____________________________________________________________
consensus GACCCCAAAATCGGGTACGAGTGCGTTGAGAATCCGGCGAAGTTAATTGAGGTGGATTCG
 
. : . : . : . : . : . :
JMSF051P17- AGAATTTTGAGGAGAGCAAAGCAGGAATTCCAACTCGGGGAAGCGGGATTTGTGGGGTTA
rJMSF051P17+ AGAATTTTGAGGAGAGCAAAGCAGGAATTCCAACTCGGGGAAGCGGGATTTGTGGGGTTA
                      ____________________________________________________________
consensus AGAATTTTGAGGAGAGCAAAGCAGGAATTCCAACTCGGGGAAGCGGGATTTGTGGGGTTA
 
. : . : . : . : . : . :
JMSF051P17- GGAGGGTTTAGGAATGTGAGGAATGTGTATGAGTGGAAAGGTGTGAAGTTAGAAGTANAT
rJMSF051P17+ GGAGGGTTTAGGAATGTGAGGAATGTGTATGAGTGGAAAGGTGTGAAGTTAGAAGTAGAT
                      ____________________________________________________________
consensus GGAGGGTTTAGGAATGTGAGGAATGTGTATGAGTGGAAAGGTGTGAAGTTAGAAGTAGAT
 
. : . : . : . : . : . :
JMSF051P17- GAAACAATGTACGATTTCGGCACTCTATATGAGATTGAATGTGAGAGCACGGAACCAGAT
rJMSF051P17+ GAAACAATGTACGATTTCGGCACTCTATATGAGATTGAATGTGAGAGCACGGAACCAGAT
                      ____________________________________________________________
consensus GAAACAATGTACGATTTCGGCACTCTATATGAGATTGAATGTGAGAGCACGGAACCAGAT
 
. : . : . : . : . : . :
JMSF051P17- AAAGTAAAGGGGATGATTGAGGAATTCTTGAANGANAATGGGGTTGAGTATTCTTATTCT
rJMSF051P17+ AAAGTAAAGGGGATGATTGAGGAATTCTTGAAGGAGAATGGGGTTGAGTATTCTTATTCT
                      ____________________________________________________________
consensus AAAGTAAAGGGGATGATTGAGGAATTCTTGAAGGAGAATGGGGTTGAGTATTCTTATTCT
 
. : . : . : . : . : . :
JMSF051P17- GANAANTCCAAGTTTGCAACTTTCANGGCANGGAANTTGCCTTANTATGTATAATTATGC
rJMSF051P17+ GAGAAGTCCAAGTTTGCAACTTTCAGGGCAGGGAAGTTGCCTTAGTATGTATAATTATGC
                      ____________________________________________________________
consensus GAGAAGTCCAAGTTTGCAACTTTCAGGGCAGGGAAGTTGCCTTAGTATGTATAATTATGC
 
. : . : . : . : . : . :
JMSF051P17- GGTTGA
rJMSF051P17+ GGTTGAGTAATGCTCACTAGTGAGGAACAATCAAAGACATGGCAACAAATAAAGGAAGCT
                      ____________________________________________________________
consensus GGTTGAGTAATGCTCACTAGTGAGGAACAATCAAAGACATGGCAACAAATAAAGGAAGCT
 
. : . : . : . : . : . :
rJMSF051P17+ ATTTTCCCCTACATTGGTACTTGGCTATTTCATCTTCTTGATGTGTTTTATATTATCGTA
                      ____________________________________________________________
consensus ATTTTCCCCTACATTGGTACTTGGCTATTTCATCTTCTTGATGTGTTTTATATTATCGTA
 
. : . : . : . : . : . :
rJMSF051P17+ TGACAATTTTAAGAAAAATGCTGTTTAGTTGTTCCTCTGGGAGTATCAATTGCTCTAGAA
                      ____________________________________________________________
consensus TGACAATTTTAAGAAAAATGCTGTTTAGTTGTTCCTCTGGGAGTATCAATTGCTCTAGAA
 
. : . : . : . : . : . :
rJMSF051P17+ TCGATATGTTCTCACTTCTCAATATGCATAAACACTAAAAATTGGTACAAATGAAAATGC
                      ____________________________________________________________
consensus TCGATATGTTCTCACTTCTCAATATGCATAAACACTAAAAATTGGTACAAATGAAAATGC