Previous Contig 013969:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030P09Sequence666008078 (3)gb:AY084362_15694536e-55Arabidopsis thaliana clone 105450 mRNA, complete sequence.688013969 (3)gb:AY260746_15934314e-16Populus tremula x Populus tremuloides UDP-glucose pyrophosphorylase mRNA, comple
JMSF038O11Sequence385008078 (3)gb:AY084362_15694531e-27Arabidopsis thaliana clone 105450 mRNA, complete sequence.781013969 (3)gb:AY260746_15934311e-28Populus tremula x Populus tremuloides UDP-glucose pyrophosphorylase mRNA, comple
JMSF051N07Sequence688008078 (3)gb:AY084362_15694531e-51Arabidopsis thaliana clone 105450 mRNA, complete sequence.719013969 (3)gb:AY260746_15934314e-16Populus tremula x Populus tremuloides UDP-glucose pyrophosphorylase mRNA, comple

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038O11+ GGATGTAATTATCAATAATATT
                      ____________________________________________________________
consensus GGATGTAATTATCAATAATATT
 
. : . : . : . : . : . :
rJMSF038O11+ GAGTCTCTCAATTCAAAATATGGCTGCAATATCCCTTTGCTTCTGATGAGCNCAGTAAAC
                      ____________________________________________________________
consensus GAGTCTCTCAATTCAAAATATGGCTGCAATATCCCTTTGCTTCTGATGAGCNCAGTAAAC
 
. : . : . : . : . : . :
rJMSF038O11+ ACCGAAAAGGGTATCCAGAAGGTCTTGGCAAAACATTCTAATAAAAACATNTACTCCNTG
                      ____________________________________________________________
consensus ACCGAAAAGGGTATCCAGAAGGTCTTGGCAAAACATTCTAATAAAAACATNTACTCCNTG
 
. : . : . : . : . : . :
rJMSF038O11+ CTTCAGCATCATGAAGAAACTAGTGGTAATGATGTGCATCAGCAGTCTCAAAAACCAAGT
rJMSF030P09+ TTCAGCATCATGAAGAAACTAGTGGTAATGATGTGCATCAGCAGTCTCAAAAACCAAGT
rJMSF051N07+ TTCAGCATCATGAAGAAACTAGTGGTAATGATGTGCATCAGCAGTCTCAAAAACCAAGT
                      ____________________________________________________________
consensus CTTCAGCATCATGAAGAAACTAGTGGTAATGATGTGCATCAGCAGTCTCAAAAACCAAGT
 
. : . : . : . : . : . :
rJMSF038O11+ CCCAAGGATGAANTATATCCTTCCAATCNGAATGAGGTTTTCATTTCCTTGAAGAAGAGT
rJMSF030P09+ CCCAAGGATGAATTATATCCTTCCAATCTGAATGAGGTTTTCATTTCCTTGAAGAAGAGT
rJMSF051N07+ CCCAAGGATGAATTATATCCTTCCAATCTGAATGAGGTTTTCATTTCCTTGAAGAAGAGT
                      ____________________________________________________________
consensus CCCAAGGATGAATTATATCCTTCCAATCTGAATGAGGTTTTCATTTCCTTGAAGAAGAGT
 
. : . : . : . : . : . :
rJMSF038O11+ TGGAAACTTGATGTGCTATTGTCCCAGGGTAAAGAGTATATCCTTCTGGTGCAGCCAGAC
rJMSF030P09+ TGGAAACTTGATGTGCTATTGTCCCAGGGTAAAGAGTATATCCTTCTGGTGCAGCCAGAC
rJMSF051N07+ TGGAAACTTGATGTGCTATTGTCCCAGGGTAAAGAGTATATCCTTCTGGTGCAGCCAGAC
                      ____________________________________________________________
consensus TGGAAACTTGATGTGCTATTGTCCCAGGGTAAAGAGTATATCCTTCTGGTGCAGCCAGAC
 
. : . : . : . : . : . :
rJMSF038O11+ AACCTTGNTGATTTGGTTGATCCAAAAATCCTAAGTCATCTGATTAGAAACAATATCCAA
rJMSF030P09+ AACCTTGCTGATTTGGTTGATCCAAAAATCCTAAGTCATCTGATTAGAAACAATATCCAA
rJMSF051N07+ AACCTTGCTGATTTGGTTGATCCAAAAATCCTAAGTCATCTGATTAGAAACAATATCCAA
                      ____________________________________________________________
consensus AACCTTGCTGATTTGGTTGATCCAAAAATCCTAAGTCATCTGATTAGAAACAATATCCAA
 
. : . : . : . : . : . :
rJMSF038O11+ TACTGCGTTGAGGTGTTGCCTACAACNTTCGGTGCGGAAAATAGCGACNTTGCTCGTGAA
rJMSF030P09+ TACTGCGTTGAGGTGTTGCCTACAACTTTCGGTGCGGAAAATAGCGACTTTGCTCGTGAA
rJMSF051N07+ TACTGCGTTGAGGTGTTGCCTACAACTTTCGGTGCGGAAAATAGCGACTTTGCTCGTGAA
                      ____________________________________________________________
consensus TACTGCGTTGAGGTGTTGCCTACAACTTTCGGTGCGGAAAATAGCGACTTTGCTCGTGAA
 
. : . : . : . : . : . :
rJMSF038O11+ CAAAAGGTTCAGGNGGAGGATTNGAAGTCTACTAAGAAACTGTGGANGAATATGAATCNC
rJMSF030P09+ CAAAAGGTTCAGGTGGAGGATTTGAAGTCTACTAAGAAACTGTGGATGAATATGAATCTC
rJMSF051N07+ CAAAAGGTTCAGGTGGAGGATTTGAAGTCTACTAAGAAACTGTGGATGAATATGAATCTC
                      ____________________________________________________________
consensus CAAAAGGTTCAGGTGGAGGATTTGAAGTCTACTAAGAAACTGTGGATGAATATGAATCTC
 
. : . : . : . : . : . :
rJMSF038O11+ ATTGAATCACTAGCAAGAAGAACTTCGNTGAATTTCTCGATATCAGAGTTTCTAAATCGG
rJMSF030P09+ ATTGAATCACTAGCAAGAAGAACTTCGCTGAATTTCTCGATATCAGAGTTTCTAAATCGG
rJMSF051N07+ ATTGAATCACTAGCAAGAAGAACTTCGCTGAATTTCTCGATATCAGAGTTTCTAAATCGG
                      ____________________________________________________________
consensus ATTGAATCACTAGCAAGAAGAACTTCGCTGAATTTCTCGATATCAGAGTTTCTAAATCGG
 
. : . : . : . : . : . :
rJMSF038O11+ CCCTTCGCNGTTGCTGTTCCAAAACCAGAAGTTGACTGCGTTTGAGAAGAGTACCNCGGA
rJMSF030P09+ CCCTTCGCTGTTGCTGTTCCAAAACCAGAAGTTGACTGCGTTTGAGAAGAGTACCNCGGA
rJMSF051N07+ CCCTTCGCTGTTGCTGTTCCAAAACCAGAAGTTGACTGCGTTTGAGAAGAGTACCNCGGA
                      ____________________________________________________________
consensus CCCTTCGCTGTTGCTGTTCCAAAACCAGAAGTTGACTGCGTTTGAGAAGAGTACCNCGGA
 
. : . : . : . : . : . :
rJMSF038O11+ GTACTTTTTTTTTTACCCCGGCGTAGATTAGCTGCTGGATTATTATTATTATTATTATTA
rJMSF030P09+ GTACTTTTTTTTTTACCCCGGCGTAGATTAGCTGCTGGATTATTATTATTATTATTATTA
rJMSF051N07+ GTACTTTTTTTTTTACCCCGGCGTAGATTAGCTGCTGGATTATTATTATTATTATTATTA
                      ____________________________________________________________
consensus GTACTTTTTTTTTTACCCCGGCGTAGATTAGCTGCTGGATTATTATTATTATTATTATTA
 
. : . : . : . : . : . :
rJMSF038O11+ TTATTGAAGAATTTGTATAATGTGTGACGCGCGNTGCATAATTGATTATGCACCGTGGTA
rJMSF030P09+ TTATTGAAGAATTTGTATAATGTGTGACGCGCGGTGCATAATTGATTATGCACCGTGGTA
rJMSF051N07+ TTATTGAAGAATTTGTATAATGTGTGACGCGCGGTGCATAATTGATTATGCACCGTGGTA
                      ____________________________________________________________
consensus TTATTGAAGAATTTGTATAATGTGTGACGCGCGGTGCATAATTGATTATGCACCGTGGTA
 
. : . : . : . : . : . :
rJMSF038O11+ TTACNCAATCTCGTAGGCGGTCGCAATCACTANTCGACG
rJMSF030P09+ TTACTCAATCTCGTAGGCGGTCGCAATCACTATTCGACGATGTATCTATGCCTTATGAGT
rJMSF051N07+ TTACTCAATCTCGTAGGCGGTCGCAATCACTATTCGACGATGTATCTATGCCTTATGAGT
                      ____________________________________________________________
consensus TTACTCAATCTCGTAGGCGGTCGCAATCACTATTCGACGATGTATCTATGCCTTATGAGT
 
. : . : . : . : . : . :
rJMSF030P09+ TATGACCCTAGTTCCTATTGGTAGT
rJMSF051N07+ TATGACCCTAGTTCCTATTGGTAGTTGAACCTTGTAACCTTATAGATAATATGACACATT
                      ____________________________________________________________
consensus TATGACCCTAGTTCCTATTGGTAGTTGAACCTTGTAACCTTATAGATAATATGACACATT