Previous Contig 013966:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF043K21Sequence803020195gb:AY050955_15624394e-58Arabidopsis thaliana putative growth regulator protein (At1g35510) mRNA, complet728013966 (2)pir|C86476|C864765e-66protein F15O4.45 [imported] - Arabidopsis thaliana>gb:AE005172_892315 Arabidopsi
JMSF051M01Sequence695007924 (3)gb:AY069892_15666342e-77Arabidopsis thaliana AT5g54510/F24B18_13 mRNA, complete cds.670013966 (2)pir|C86476|C864766e-54protein F15O4.45 [imported] - Arabidopsis thaliana>gb:AE005172_892315 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043K21+ GGGCATGATGCTAA
                      ____________________________________________________________
consensus GGGCATGATGCTAA
 
. : . : . : . : . : . :
rJMSF043K21+ GAGGCATGGGATTTGATAATAGCACCCCGGTTTATGTTGCTGCTGGAAAAATTTATAAGG
rJMSF051M01+ AAGG
                      ____________________________________________________________
consensus GAGGCATGGGATTTGATAATAGCACCCCGGTTTATGTTGCTGCTGGAAAAATTTATAAGG
 
. : . : . : . : . : . :
rJMSF043K21+ CCGAGAAGTATATGGCTCCACTC-AAACAGATATTTCCACATCTCGAATCGAAGGATACA
rJMSF051M01+ CCGAGAAGTATATGGCTCCACTCAAAACAGATATTTCCACATCTCGAATCGAAGGATACA
                      ____________________________________________________________
consensus CCGAGAAGTATATGGCTCCACTCAAAACAGATATTTCCACATCTCGAATCGAAGGATACA
 
. : . : . : . : . : . :
rJMSF043K21+ CTTGCTTCTGCAGAAGAACTAGCTCCGTTTGAGGGACATTTATCTAGGTTGGCGGCTCTT
rJMSF051M01+ CTTGCTTCTGCAGAAGAACTAGCTCCGTTTGAGGGACATTTATCTAGGTTGGCGGCTCTT
                      ____________________________________________________________
consensus CTTGCTTCTGCAGAAGAACTAGCTCCGTTTGAGGGACATTTATCTAGGTTGGCGGCTCTT
 
. : . : . : . : . : . :
rJMSF043K21+ GATTATACGGTTTGCCTCTACAGTGAAGTTTTTGTCACAACACAGGGTGGTAACTTCCCG
rJMSF051M01+ GATTATACGGTTTGCCTCTACAGTGAAGTTTTTGTCACAACACAGGGTGGTAACTTCCCG
                      ____________________________________________________________
consensus GATTATACGGTTTGCCTCTACAGTGAAGTTTTTGTCACAACACAGGGTGGTAACTTCCCG
 
. : . : . : . : . : . :
rJMSF043K21+ CATTTCTTAGTGGGTCATAGACGCTATTTGAATGGAGGACATGGCAAGACAATCAAACCC
rJMSF051M01+ CATTTCTTAGTGGGTCATAGACGCTATTTGAATGGAGGACATGGCAAGACAATCAAACCC
                      ____________________________________________________________
consensus CATTTCTTAGTGGGTCATAGACGCTATTTGAATGGAGGACATGGCAAGACAATCAAACCC
 
. : . : . : . : . : . :
rJMSF043K21+ GATAAGCGGAAATTAGTTCTTCTGTTTGATCGTCCAAGTATAAGATATAAAGACTTTAAA
rJMSF051M01+ GATAAGCGGAAATTAGTTCTTCTGTTTGATCGTCCAAGTATAAGATATAAAGACTTTAAA
                      ____________________________________________________________
consensus GATAAGCGGAAATTAGTTCTTCTGTTTGATCGTCCAAGTATAAGATATAAAGACTTTAAA
 
. : . : . : . : . : . :
rJMSF043K21+ CGGCAGTTGCAAGATATGCTTCATCACAACGACATGAAGGGTTGTGAGGTAAAAAAAACC
rJMSF051M01+ CGGCAGTTGCAAGATATGCTTCATCACAACGACATGAAGGGTTGTGAGGT-AAAAAAACC
                      ____________________________________________________________
consensus CGGCAGTTGCAAGATATGCTTCATCACAACGACATGAAGGGTTGTGAGGTAAAAAAAACC
 
. : . : . : . : . : . :
rJMSF043K21+ CAGCAACTCGCTCTATACATACCCAATGCCCGACTGCATGTGCAAACAAGCAGATGTGAA
rJMSF051M01+ CAGCAACTCGCTCTATACATACCCAATGCCCGACTGCATGTGCAAACAAGCAGATGTGAA
                      ____________________________________________________________
consensus CAGCAACTCGCTCTATACATACCCAATGCCCGACTGCATGTGCAAACAAGCAGATGTGAA
 
. : . : . : . : . : . :
rJMSF043K21+ TAATGAAAGCGGTAATACCACAAAAGCCCTTTAATACATAGGATACATACACATATTCCA
rJMSF051M01+ TAATGAAAGCGGTAATACCACAAAAGCCCTTTAATACATAGGATACATACACATATTCCA
                      ____________________________________________________________
consensus TAATGAAAGCGGTAATACCACAAAAGCCCTTTAATACATAGGATACATACACATATTCCA
 
. : . : . : . : . : . :
rJMSF043K21+ TAGAGTTTTTTGGGTTTACATACGTGTAATTTATATGTAGCTTAAAATTTCTGCCCGCCC
rJMSF051M01+ TAGAGTTTTTTGGGTTTACATACGTGTAATTTATATGTAGCTTAAAATTTCTGCCCGCCC
                      ____________________________________________________________
consensus TAGAGTTTTTTGGGTTTACATACGTGTAATTTATATGTAGCTTAAAATTTCTGCCCGCCC
 
. : . : . : . : . : . :
rJMSF043K21+ CGGGGCGATATTATGGAGGCCTATTGTTCATCTTATAGGTATTGTATTCCTTAGAGATTC
rJMSF051M01+ CGGGGCGATATTATGGAGGCCTATTGTTCATCTTATAGGTATTGTATTCCTTAGAGATTC
                      ____________________________________________________________
consensus CGGGGCGATATTATGGAGGCCTATTGTTCATCTTATAGGTATTGTATTCCTTAGAGATTC
 
. : . : . : . : . : . :
rJMSF043K21+ TTCGAGGTCCATTGAGGGGTTGGTTTGGTGATAGTTCTGAAAT
rJMSF051M01+ TTCGAGGTCCATTGAGGGGTTGGTTTGGTGATAGTTCTGAAATTGTTAACTCACTCTGCA
                      ____________________________________________________________
consensus TTCGAGGTCCATTGAGGGGTTGGTTTGGTGATAGTTCTGAAATTGTTAACTCACTCTGCA