Previous Contig 013965:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF051L23Sequence677013965 (2)pir|E85041|E850419e-36probable D-type cyclin [imported] - Arabidopsis thaliana>gb:AC005275_1532358 Ara728013965 (2)pir|E85041|E850413e-18probable D-type cyclin [imported] - Arabidopsis thaliana>gb:AC005275_1532358 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051L23- AAAAAACAGAGAGCTTCAAGGAGACATCATATCATCATGGAGTT
                      ____________________________________________________________
consensus AAAAAACAGAGAGCTTCAAGGAGACATCATATCATCATGGAGTT
 
. : . : . : . : . : . :
JMSF051L23- TGACCTCGAAAACCCATTGCCGATTTGCCATCATGCCCTTCCCTCCGACACCACCGTTTT
                      ____________________________________________________________
consensus TGACCTCGAAAACCCATTGCCGATTTGCCATCATGCCCTTCCCTCCGACACCACCGTTTT
 
. : . : . : . : . : . :
JMSF051L23- ACCTATTCAACGTCGAATCTGATCACATGCCTGCAACGACGTATCATCACACCCTCGTTT
                      ____________________________________________________________
consensus ACCTATTCAACGTCGAATCTGATCACATGCCTGCAACGACGTATCATCACACCCTCGTTT
 
. : . : . : . : . : . :
JMSF051L23- CCGCCGCCGCAGATTTTCACTTCTCCGTTCGCCGCGAAACCATCTCTCTCATTCTTCAAC
                      ____________________________________________________________
consensus CCGCCGCCGCAGATTTTCACTTCTCCGTTCGCCGCGAAACCATCTCTCTCATTCTTCAAC
 
. : . : . : . : . : . :
JMSF051L23- TCTCCCGTCGCTACGACGCCGTCACATGCTATCTCGCTGTAAACTACGTCGACCGCTTCC
                      ____________________________________________________________
consensus TCTCCCGTCGCTACGACGCCGTCACATGCTATCTCGCTGTAAACTACGTCGACCGCTTCC
 
. : . : . : . : . : . :
JMSF051L23- TCTCCTTCCATCCCTTACCGGAAGGGAGGCCATGGATCCTGAAGCTTGTTGCAGCTTCTT
                      ____________________________________________________________
consensus TCTCCTTCCATCCCTTACCGGAAGGGAGGCCATGGATCCTGAAGCTTGTTGCAGCTTCTT
 
. : . : . : . : . : . :
JMSF051L23- GTGTCATTTTGGCTTTGAAGATGAGAAAAGCAGAGTTTTCAGTTTCTGATATTCAGCAAG
rJMSF051L23+ TCAGCAAG
                      ____________________________________________________________
consensus GTGTCATTTTGGCTTTGAAGATGAGAAAAGCAGAGTTTTCAGTTTCTGATATTCAGCAAG
 
. : . : . : . : . : . :
JMSF051L23- ACAGCGGTGTGATATTTGATTTAGAAA-CAATCGAGAGAATGGAGATGTTGATTCTGGGA
rJMSF051L23+ ACAGCGGTGTGATATTTGATTTAGAAACCAATCGAGAGAATGGAGATGTTGATTCTGGGA
                      ____________________________________________________________
consensus ACAGCGGTGTGATATTTGATTTAGAAACCAATCGAGAGAATGGAGATGTTGATTCTGGGA
 
. : . : . : . : . : . :
JMSF051L23- ACATTAAAATGGCGAATGCGGTCGGTGACTCCATTCTGTTTCCTTAATTTCTTCATCTCA
rJMSF051L23+ ACATTAAAATGGCGAATGCGGTCGGTGACTCCATTCTGTTTCCTTAATTTCTTCATCTCA
                      ____________________________________________________________
consensus ACATTAAAATGGCGAATGCGGTCGGTGACTCCATTCTGTTTCCTTAATTTCTTCATCTCA
 
. : . : . : . : . : . :
JMSF051L23- TTCTTCAAATTCAAAGAGCCACCATTGCGCCAAGCTCTCAAGGCCAGGGCGACAGAGATC
rJMSF051L23+ TTCTTCAAATTCAAAGAGCCACCATTGCGCCAAGCTCTCAAGGCCAGGGCGACAGAGATC
                      ____________________________________________________________
consensus TTCTTCAAATTCAAAGAGCCACCATTGCGCCAAGCTCTCAAGGCCAGGGCGACAGAGATC
 
. : . : . : . : . : . :
JMSF051L23- ATCTTCAAATCACAAACTGAAATCAATTTACTCAAGTTCAGGCCATCTATAATCTCTGCA
rJMSF051L23+ ATCTTCAAATCACAAACTGAAATCAATTTACTCAAGTTCAGGCCATCTATAATCTCTGCA
                      ____________________________________________________________
consensus ATCTTCAAATCACAAACTGAAATCAATTTACTCAAGTTCAGGCCATCTATAATCTCTGCA
 
. : . : . : . : . : . :
JMSF051L23- TCAGCTCTTCTCTCCGCCTGCGATGAACTCTTCC
rJMSF051L23+ TCAGCTCTTCTCTCCGCCTGCGATGAACTCTTCCCCCTACAGTTTCATTGCTACAGAAAT
                      ____________________________________________________________
consensus TCAGCTCTTCTCTCCGCCTGCGATGAACTCTTCCCCCTACAGTTTCATTGCTACAGAAAT
 
. : . : . : . : . : . :
rJMSF051L23+ GCAATCTTAAACAGCCCATATGTAAATACTGAAAATTTGGTAAGCTGTTACGGGGTGATG
                      ____________________________________________________________
consensus GCAATCTTAAACAGCCCATATGTAAATACTGAAAATTTGGTAAGCTGTTACGGGGTGATG
 
. : . : . : . : . : . :
rJMSF051L23+ CAAGAGATTGCAAGGAAGGGGTACGAGTCAGTGATGGAGAGCAATATGGTATCGAGCTCG
                      ____________________________________________________________
consensus CAAGAGATTGCAAGGAAGGGGTACGAGTCAGTGATGGAGAGCAATATGGTATCGAGCTCG
 
. : . : . : . : . : . :
rJMSF051L23+ TCGACGCCGGTGAACGTTCTTGATTTGCAATGCTGGAGTTGGGAAAACGACGGGAGCGAC
                      ____________________________________________________________
consensus TCGACGCCGGTGAACGTTCTTGATTTGCAATGCTGGAGTTGGGAAAACGACGGGAGCGAC
 
. : . : . : . : . : . :
rJMSF051L23+ ACGACGGCGGCAGGAGGTGCAGAAAACAGTGGCTGCAGTGGCGGGGAGGTGGTGGCCACC
                      ____________________________________________________________
consensus ACGACGGCGGCAGGAGGTGCAGAAAACAGTGGCTGCAGTGGCGGGGAGGTGGTGGCCACC
 
. : . : . : . : . : . :
rJMSF051L23+ GGGCGCGAAAGGGACTTGAAACGGCGAAAATTTGATCGGTTCAGCCTGCAGGGCAGATGC
                      ____________________________________________________________
consensus GGGCGCGAAAGGGACTTGAAACGGCGAAAATTTGATCGGTTCAGCCTGCAGGGCAGATGC
 
. : . : . : . : . : . :
rJMSF051L23+ AACAAAAATGGTAGCAGCAGCAGCAGCTAAGATGAGGTGCGTGATGCATAGAGACAGACC
                      ____________________________________________________________
consensus AACAAAAATGGTAGCAGCAGCAGCAGCTAAGATGAGGTGCGTGATGCATAGAGACAGACC
 
. : . : . : . : . : . :
rJMSF051L23+ CCACAGCGCCTTAGGAGTCTGGCCCATTCGAGAGCGACCCTAGACTGGAATTTCATCGAA
                      ____________________________________________________________
consensus CCACAGCGCCTTAGGAGTCTGGCCCATTCGAGAGCGACCCTAGACTGGAATTTCATCGAA