Previous Contig 013960:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF032J21Sequence633013960 (6)pir|T45834|T458346e-34hypothetical protein F2K15.150 - Arabidopsis thaliana>gb:ATF2K15_1550535 Arabido628013960 (6)gb:AK118112_18161078e-04Arabidopsis thaliana At3g49290 mRNA for unknown protein, complete cds, clone: RA
JMSF038F17Sequence670013960 (6)pir|T45834|T458344e-38hypothetical protein F2K15.150 - Arabidopsis thaliana>gb:ATF2K15_1550535 Arabido960013960 (6)pir|T45834|T458345e-47hypothetical protein F2K15.150 - Arabidopsis thaliana>gb:ATF2K15_1550535 Arabido
JMSF051K15Sequence635013960 (6)pir|T45834|T458344e-38hypothetical protein F2K15.150 - Arabidopsis thaliana>gb:ATF2K15_1550535 Arabido777013960 (6)pir|T45834|T458348e-18hypothetical protein F2K15.150 - Arabidopsis thaliana>gb:ATF2K15_1550535 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032J21- GAAGCTTTACCCTCTT
JMSF051K15- GAAGCTTTACCCTCTT
JMSF038F17- GAAGCTTTACCCTCTT
                      ____________________________________________________________
consensus GAAGCTTTACCCTCTT
 
. : . : . : . : . : . :
JMSF032J21- CCATTTTCACCAAAAATCAGGTTTGAGACTACTCCAACTTCATGGGGACTGAATTAGCTC
JMSF051K15- CCATTTTCACCAAAAATCAGGTTTGAGACTACTCCAACTTCATGGGGACTGAATTAGCTC
JMSF038F17- CCATTTTCACCAAAAATCAGGTTTGAGACTACTCCAACTTCATGGGGACTGAATTAGCTC
rJMSF038F17+ CTGAATTAGNTC
                      ____________________________________________________________
consensus CCATTTTCACCAAAAATCAGGTTTGAGACTACTCCAACTTCATGGGGACTGAATTAGCTC
 
. : . : . : . : . : . :
JMSF032J21- ATCAAGAAAGAAACAACTATGATGAAATCCTTATGCA--ACAGAACAAACATTACTGACA
JMSF051K15- ATCAAGAAAGAAACAACTATGATGAAATCCTTATGCAACACAGAACAAACATTACTGACA
JMSF038F17- ATCAAGAAAGAAACAACTATGATGAAATCCTTATGCAACACAGAACAAACATTACTGACA
rJMSF038F17+ ATCANGAAAGNAACAACTATGATGAAATCCTTATGCAACACAGAACAAACATTACTGACA
                      ____________________________________________________________
consensus ATCAAGAAAGAAACAACTATGATGAAATCCTTATGCAACACAGAACAAACATTACTGACA
 
. : . : . : . : . : . :
JMSF032J21- GTTTGAAGGATTTGAAGAATCTGAGGAAACAGTTTTACTCGGCTGCAGAATATTTTGAAG
JMSF051K15- GTTTGAAGGATTTGAAGAATCTGAGGAAACAGTTTTACTCGGCTGCAGAATATTTTGAAG
JMSF038F17- GTTTGAAGGATTTGAAGAATCTGAGGAAACAGTTTTACTCGGCTGCAGAATATTTTGAAG
rJMSF038F17+ GNTTGAAGGATTTGAAGAATNTGAGGAAACAGTTTTACTCGGNTGCAGAATATTTTGAAG
                      ____________________________________________________________
consensus GTTTGAAGGATTTGAAGAATCTGAGGAAACAGTTTTACTCGGCTGCAGAATATTTTGAAG
 
. : . : . : . : . : . :
JMSF032J21- TGTCTTATGGCAAAGATGAGCACAAACAAGAATTGGTGGATACCATGAAAGTTTATGTGA
JMSF051K15- TGTCTTATGGCAAAGATGAGCACAAACAAGAATTGGTGGATACCATGAAAGTTTATGTGA
JMSF038F17- TGTCTTATGGCAAAGATGAGCACAAACAAGAATTGGTGGATACCATGAAAGTTTATGTGA
rJMSF038F17+ TGTCTTATGGCAAAGATGAGCACAAACAAGAATTGGTGGATACCATGAAAGTTTATGTGA
                      ____________________________________________________________
consensus TGTCTTATGGCAAAGATGAGCACAAACAAGAATTGGTGGATACCATGAAAGTTTATGTGA
 
. : . : . : . : . : . :
JMSF032J21- GCAAAGCTGTGATTAACACAGTGGATCACCTTGGTTCTATAGCTGCTAAACTTGACACTT
JMSF051K15- GCAAAGCTGTGATTAACACAGTGGATCACCTTGGTTCTATAGCTGCTAAACTTGACACTT
JMSF038F17- GCAAAGCTGTGATTAACACAGTGGATCACCTTGGTTCTATAGCTGCTAAACTTGACACTT
rJMSF038F17+ GCAAAGCTGTGATTAACACAGTGGATCACCTTGGTTCTATAGCTGCTAAACTTGACACTT
                      ____________________________________________________________
consensus GCAAAGCTGTGATTAACACAGTGGATCACCTTGGTTCTATAGCTGCTAAACTTGACACTT
 
. : . : . : . : . : . :
JMSF032J21- TCTTGGATGAAAAAGTTGGTGAATTTTCTGCAACAGAACTTCGATTCTCTTGCGTTGAAC
JMSF051K15- TCTTGGATGAAAAAGTTGGTGAATTTTCTGCAACAGAACTTCGATTCTCTTGCGTTGAAC
JMSF038F17- TCTTGGATGAAAAAGTTGGTGAATTTTCTGCAACAGAACTTCGATTCTCTTGCGTTGAAC
rJMSF038F17+ TCTTGGATGAAAAAGTTGGTGAATTTTCTGCAACAGAACTTCGATTCTCTTGCGTTGAAC
rJMSF051K15+ TTGGATGAAAAAGTTGGTGAA-TTTNTGCAACAGAACTTCGATTCTCTTGCGTTGAAC
                      ____________________________________________________________
consensus TCTTGGATGAAAAAGTTGGTGAATTTTCTGCAACAGAACTTCGATTCTCTTGCGTTGAAC
 
. : . : . : . : . : . :
JMSF032J21- AGAGATCAAGATCATGCCAAGAATTCATCGACCGAAATGGCATTGAACAACAATCATTTG
JMSF051K15- AGAGATCAAGATCATGCCAAGAATTCATCGACCGAAATGGCATTGAACAACAATCATTTG
JMSF038F17- AGAGATCAAGATCATGCCAAGAATTCATCGACCGAAATGGCATTGAACAACAATCATTTG
rJMSF038F17+ AGAGATCAAGATCATGCCAAGAATTCATCGACCGAAATGGCATTGAACAACAATCATTTG
rJMSF051K15+ AGAGATCAAGATCATGCCAAGAATTCATCGACCGAAATGGCATTGAACAACAATCATTTG
                      ____________________________________________________________
consensus AGAGATCAAGATCATGCCAAGAATTCATCGACCGAAATGGCATTGAACAACAATCATTTG
 
. : . : . : . : . : . :
JMSF032J21- TCACTGTTTTGCCCAAGTACCTGAAACATTGTATCAATCCAGGTTCAGATGTGGATACAG
JMSF051K15- TCACTGTTTTGCCCAAGTACCTGAAACATTGTATCAATCCAGGTTCAGATGTGGATACAG
JMSF038F17- TCACTGTTTTGCCCAAGTACCTGAAACATTGTATCAATCCAGGTTCAGATGTGGATACAG
rJMSF038F17+ TCACTGTTTTGCCCAAGTACCTGAAACATTGTATCAATCCAGGTTCAGATGTGGATACAG
rJMSF032J21+ TTGTATCAATCCAGGTTCAGATGTGGATACAG
rJMSF051K15+ TCACTGTTTTGCCCAAGTACCTGAAACATTGTATCAATCCAGGTTCAGATGTGGATACAG
                      ____________________________________________________________
consensus TCACTGTTTTGCCCAAGTACCTGAAACATTGTATCAATCCAGGTTCAGATGTGGATACAG
 
. : . : . : . : . : . :
JMSF032J21- TGTCTGATTTAGGAAAATCAAACAGGAGAAGTCCTATGATGACAATTCTCTATCCTGGCC
JMSF051K15- TGTCTGATTTAGGAAAATCAAACAGGAGAAGTCCTATGATGACAATTCTCTATCCTGGCC
JMSF038F17- TGTCTGATTTAGGAAAATCAAACAGGAGAAGTCCTATGATGACAATTCTCTATCCTGGCC
rJMSF038F17+ TGTCTGATTTAGGAAAATCAAACAGGAGAAGTCCTATGATGACAATTCTCTATCCTGGCC
rJMSF032J21+ TGTCTGATTTAGGNAANTCANACNGGAGAAGTCCTATGATGACAATTCTCTATCCTGGCC
rJMSF051K15+ TGTCTGATTTAGGAAAATCAAACAGGAGAAGTCCTATGATGACAATTCTCTATCCTGGCC
                      ____________________________________________________________
consensus TGTCTGATTTAGGAAAATCAAACAGGAGAAGTCCTATGATGACAATTCTCTATCCTGGCC
 
. : . : . : . : . : . :
JMSF032J21- GGGACGAAATGCATCANAACCAGCACCACCAACTCCAGCAAGGNTTTCTAGCAACAAAAA
JMSF051K15- GGGACGAAATGCATCAAAACCAGCACCACCAACTCCAGCAAGGTTTTCTAGCAACAAAAA
JMSF038F17- GGGACGAAATGCATCAAAACCAGCACCACCAACTCCAGCAAGGTTTTCTAGCAACAAAAA
rJMSF038F17+ GGGACGAAATGCATCAAAACCAGCACCACCAACTCCAGCAAGGTTTTCTAGCAACAAAAA
rJMSF032J21+ GGGACGAAATGCATCAAAACCAGCACCACCAACTCCAGCAAGGTTTTCTAGCAACAAAAA
rJMSF051K15+ GGGACGAAATGCATCAAAACCAGCACCACCAACTCCAGCAAGGTTTTCTAGCAACAAAAA
                      ____________________________________________________________
consensus GGGACGAAATGCATCAAAACCAGCACCACCAACTCCAGCAAGGTTTTCTAGCAACAAAAA
 
. : . : . : . : . : . :
JMSF032J21- CAAAAGAGCATCCTACCTT
JMSF051K15- CAAAAGAGCATCCTACCTT
JMSF038F17- CAAAAGAGCATCCTACCTTACCAAGGAGAAGGCTGCAGAATAACCTTACATTTA
rJMSF038F17+ CAAAAGAGCATCCTACCTTACCAAGGAGAAGGCTGCAGAATAACCTTACATTTACACAAA
rJMSF032J21+ CAAAAGAGCATCCTACCTTACCAAGGAGAAGGCTGCAGAATAACCTTACATTTACACAAA
rJMSF051K15+ CAAAAGAGCATCCTACCTTACCAAGGAGAAGGCTGCAGAATAACCTTACATTTACACAAA
                      ____________________________________________________________
consensus CAAAAGAGCATCCTACCTTACCAAGGAGAAGGCTGCAGAATAACCTTACATTTACACAAA
 
. : . : . : . : . : . :
rJMSF038F17+ CTTCTCCAAATCCTCCTGCATTCACATTTACCCGGGCTGCATCTAGCAAAGAATTAGATT
rJMSF032J21+ CTTCTCCAAATCCTCCTGCATTCACATTTACCCGGGCTGCATCTAGCAAAGAATTAGATT
rJMSF051K15+ CTTCTCCAAATCCTCCTGCATTCACATTTACCCGGGCTGCATCTAGCAAAGAATTAGATT
                      ____________________________________________________________
consensus CTTCTCCAAATCCTCCTGCATTCACATTTACCCGGGCTGCATCTAGCAAAGAATTAGATT
 
. : . : . : . : . : . :
rJMSF038F17+ CCAGAGGGAAGCTGTCTGTTTCGCCACTTCGGTTTCGACTCAAGCGCTCTGAATCATACA
rJMSF032J21+ CCAGAGGGAAGCTGTCTGTTTCGCCACTTCGGTTTCGANTCAAGCGCTCTGAATCATACA
rJMSF051K15+ CCAGAGGGAAGCTGTCTGTTTCGCCACTTCGGTTTCGACTCAAGCGCTCTGAATCATACA
                      ____________________________________________________________
consensus CCAGAGGGAAGCTGTCTGTTTCGCCACTTCGGTTTCGACTCAAGCGCTCTGAATCATACA
 
. : . : . : . : . : . :
rJMSF038F17+ TTCACAGATCACCCCCTTTCAGTCCCTGCGATCTACGACAGTTTCGGCCCCAGCCGCAGA
rJMSF032J21+ TTCACAGATCACCCCCTTTCAGTCCNTGCGATCTACGACAGTTTCGGCCCCAGCCGCAGA
rJMSF051K15+ TTCACAGATCACCCCCTTTCAGTCCCTGCGATCTACGACAGTTTCGGCCCCAGCCGCAGA
                      ____________________________________________________________
consensus TTCACAGATCACCCCCTTTCAGTCCCTGCGATCTACGACAGTTTCGGCCCCAGCCGCAGA
 
. : . : . : . : . : . :
rJMSF038F17+ GGACAATTTCACTGCCCACAAAGCCTGCAAAACCTACTTCACAGAATATGAAGAAACTGC
rJMSF032J21+ GGACAATTTCACTGCCCACAAAGCCTGCAAAACNTACTTCACAGAATATGAAGAAACTGC
rJMSF051K15+ GGACAATTTCACTGCCCACAAAGCCTGCAAAACCTACTTCACAGAATATGAAGAAACTGC
                      ____________________________________________________________
consensus GGACAATTTCACTGCCCACAAAGCCTGCAAAACCTACTTCACAGAATATGAAGAAACTGC
 
. : . : . : . : . : . :
rJMSF038F17+ AGTCCAACAAGACTAAACGTACACTCCAATCACTGCTTAGCTTTCAATTCACGGATTAAG
rJMSF032J21+ AGTCCAACAAGACTAAACGTACACTCCAATCACTGCTTAGCTTTCAATTCACGGATTAAG
rJMSF051K15+ AGTCCAACAAGACTAAACGTACACTCCAATCACTGCTTAGCTTTCAATTCACGGATTAAG
                      ____________________________________________________________
consensus AGTCCAACAAGACTAAACGTACACTCCAATCACTGCTTAGCTTTCAATTCACGGATTAAG
 
. : . : . : . : . : . :
rJMSF038F17+ AAGCTAAGGATATTGAGATATTTCACAGTCTTGTAA-TTTACACAAAAT
rJMSF032J21+ AAGCTAAGGATATTGAGATATTTCACAGTCTNGTAATTTTACACAAAATTCTTAAATAAA
rJMSF051K15+ AAGCTAAGGATATTGAGATATTTCACAGTCTTATAATTTTACACAAAATTCTTAAATAAA
                      ____________________________________________________________
consensus AAGCTAAGGATATTGAGATATTTCACAGTCTTGTAATTTTACACAAAATTCTTAAATAAA
 
. : . : . : . : . : . :
rJMSF032J21+ GCAACTTAAAGAATTTCATTCATATTCTTGTATTTTAAGTTTACATCTGAACC
rJMSF051K15+ GCAACTTAAAGAATTTCATTCATATTCTTGTATTTTAAGTTTACATCTGAACCCTGTGCT
                      ____________________________________________________________
consensus GCAACTTAAAGAATTTCATTCATATTCTTGTATTTTAAGTTTACATCTGAACCCTGTGCT