Previous Contig 013953:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS100A06Sequence638013953 (3)gb:AY308957_15978601e-38Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMSF036B20Sequence280000146 (17)322013953 (3)gb:AY308957_15978604e-08Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.
JMSF051I14Sequence687000146 (17)gb:AY308957_15978602e-87Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.722013953 (3)gb:AY308957_15978601e-45Medicago truncatula putative serine carboxypeptidase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051I14+ TGCA
                      ____________________________________________________________
consensus TGCA
 
. : . : . : . : . : . :
rJMSF051I14+ AAATTTTCCAAGCCATAGCACTTATCGAGATGGGACCTGTTAACGTGGGTAACATTTACT
                      ____________________________________________________________
consensus AAATTTTCCAAGCCATAGCACTTATCGAGATGGGACCTGTTAACGTGGGTAACATTTACT
 
. : . : . : . : . : . :
rJMSF051I14+ CTAGCTTCTGCTTTAATGATGTCCCTAAACCACAATACCATGGTTCGGTATATGATCCTT
                      ____________________________________________________________
consensus CTAGCTTCTGCTTTAATGATGTCCCTAAACCACAATACCATGGTTCGGTATATGATCCTT
 
. : . : . : . : . : . :
JMFS100A06- GTCTTATCTCAACCGAGACGAGGTGCAGAAGGCCCTCCATG
rJMSF051I14+ GCTCAGGCGGTTATATCGCGTCTTATCTCAACCGAGACGAGGTGCAGAAGGCCCTCCATG
                      ____________________________________________________________
consensus GCTCAGGCGGTTATATCGCGTCTTATCTCAACCGAGACGAGGTGCAGAAGGCCCTCCATG
 
. : . : . : . : . : . :
JMFS100A06- CCATCAACACTTCTTGGATGGGTTGCAGTCCAAAATTTGGATTGAATCACTGGAAAGACT
rJMSF051I14+ CCATCAACACTTCTTGGATGGGTTGCAGTCCAAAATTTGGATTGAATCACTGGAAAGACT
                      ____________________________________________________________
consensus CCATCAACACTTCTTGGATGGGTTGCAGTCCAAAATTTGGATTGAATCACTGGAAAGACT
 
. : . : . : . : . : . :
JMFS100A06- CAGTAATAACAACCTTGCCCATAATCAAGCAGCTTATTGCAAACAAGATGAGAGTATGGA
rJMSF051I14+ CAGTAATAACAACCTTGCCCATAATCAAGCAGCTTATTGCAAACAAGATGAGAGTATGGA
                      ____________________________________________________________
consensus CAGTAATAACAACCTTGCCCATAATCAAGCAGCTTATTGCAAACAAGATGAGAGTATGGA
 
. : . : . : . : . : . :
JMFS100A06- TATACAGTGGTGACGTAGATGCGTTAGTTTCAGTGACATCAACTAGGTATGCAATAAAAG
rJMSF051I14+ TATACAGTGGTGACGTAGATGCGTTAGTTTCAGTGACATCAACTAGGTATGCAATAAAAG
                      ____________________________________________________________
consensus TATACAGTGGTGACGTAGATGCGTTAGTTTCAGTGACATCAACTAGGTATGCAATAAAAG
 
. : . : . : . : . : . :
JMFS100A06- CGATGAAACTTCCTGTCGAGGTTGGTTGGCGGGCGTGGCATTCCGATGGCGCCAAGGATG
rJMSF036B20+ GAGGTTGGTTGGCGGGCGTGGCATTNTGATGGCGCCAAGGATG
rJMSF051I14+ CGATGAAACTTCCTGTCGAGGTTGGTTGGCGGGCGTGGCATTCCGATGGCGCCAAGGATG
                      ____________________________________________________________
consensus CGATGAAACTTCCTGTCGAGGTTGGTTGGCGGGCGTGGCATTCCGATGGCGCCAAGGATG
 
. : . : . : . : . : . :
JMFS100A06- TGGGAGGGTACGTGGAAGCGTACAAGGGATTGACACTGGTTACTATAAGAGGAGCTGGGC
rJMSF036B20+ TGGGNGGGTACGTGGAAGCGTACAAGGGATTGACACTGGTTACTATAAGNGGAGGGGGGC
rJMSF051I14+ TGGGAGGGTACGTGGAAGCGTACAAGGGATTGACACTGGTTACTATAAGAGGAGCTGGGC
                      ____________________________________________________________
consensus TGGGAGGGTACGTGGAAGCGTACAAGGGATTGACACTGGTTACTATAAGAGGAGCTGGGC
 
. : . : . : . : . : . :
JMFS100A06- ATTCAGCTCCTAGCTTCCAACCAGAACGTGCATTTACTATGATTTCATCTTTCCTTCAAG
rJMSF036B20+ ANTCAGCTCCANGNTNCCAACCAGAACGTGCATTTANTANGATTTCATNTTTCCTTCAAG
rJMSF051I14+ ATTCAGCTCCTAGCTTCCAACCAGAACGTGCATTTACTATGATTTCATCTTTCCTTCAAG
                      ____________________________________________________________
consensus ATTCAGCTCCTAGCTTCCAACCAGAACGTGCATTTACTATGATTTCATCTTTCCTTCAAG
 
. : . : . : . : . : . :
JMFS100A06- GGAAACTTCCCCCTGCCTTCAGCTAG
rJMSF036B20+ GGAAACTCCCCCCTGCCTTCAGCTAGAAGGTGTGATAGACACGCGGNTTCAATACNGATC
rJMSF051I14+ GGAAACTTCCCCCTGCCTTCAGCTAGAAGGTGTGATAGACACGCGGATACAATAC--ATC
                      ____________________________________________________________
consensus GGAAACTTCCCCCTGCCTTCAGCTAGAAGGTGTGATAGACACGCGGATTCAATACNGATC
 
. : . : . : . : . : . :
rJMSF036B20+ TGGCTGCCCAACTTGTTCACNC-GGCTTAAGGATAACTTTTAGTTATATTGTTCCCTTTA
rJMSF051I14+ CTGCTGCCCAACTTGTTCACACTGGCTTAAGAATCAATTTTAGTTAAATTGTTTCCTTTA
                      ____________________________________________________________
consensus TTGCTGCCCAACTTGTTCACACTGGCTTAAGGATCACTTTTAGTTATATTGTTTCCTTTA
 
. : . : . : . : . : . :
rJMSF036B20+ CTACTT
rJMSF051I14+ CTACTTCATGTCCTTTCTTTTTATTAAGGATTGCCTTTATATTTAGTTCTAACAGATTTT
                      ____________________________________________________________
consensus CTACTTCATGTCCTTTCTTTTTATTAAGGATTGCCTTTATATTTAGTTCTAACAGATTTT