Previous Contig 013946:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031F04Sequence624008057 (4)395013946 (4)
JMFF032B12Sequence548008057 (4)378013946 (4)
JMFS061E12Sequence620013946 (4)gb:CAR299061_16452348e-35Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can189.
JMSF051H17Sequence691008057 (4)628013946 (4)gb:CAR299061_16452343e-13Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can189.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS061E12- GAGAG
                      ____________________________________________________________
consensus GAGAG
 
. : . : . : . : . : . :
JMFS061E12- AACGCTAAGATGGAGAAGGCTGCAAAGACTATATCTGAGATCAGCTTGGAGGTTGATAGG
                      ____________________________________________________________
consensus AACGCTAAGATGGAGAAGGCTGCAAAGACTATATCTGAGATCAGCTTGGAGGTTGATAGG
 
. : . : . : . : . : . :
JMFS061E12- CTAGCTGGACAGGTATCTGCACTTGAATCTGTTATTTCGAAAGGTGGGAAAGTTGCAGAA
                      ____________________________________________________________
consensus CTAGCTGGACAGGTATCTGCACTTGAATCTGTTATTTCGAAAGGTGGGAAAGTTGCAGAA
 
. : . : . : . : . : . :
JMFS061E12- AAGACTGTTGTGAACTTGATCGAGTTTTTGATGAACCAACTGCTTAAATTGGATGGTATT
rJMSF051H17+ CAACTGCTTAAATTGGATGGTATT
                      ____________________________________________________________
consensus AAGACTGTTGTGAACTTGATCGAGTTTTTGATGAACCAACTGCTTAAATTGGATGGTATT
 
. : . : . : . : . : . :
JMFS061E12- AATGGTGAAGGTGATGTTAAATTGCAGAGAAAAATGCAGGTAAAAAGAGTGCAAAAGTGT
rJMSF051H17+ AATGGNGAAGGTGATGTTAAATTGCAGAGAAAAATGCAGGTAAAAAGAGTGCAAAAGTGT
                      ____________________________________________________________
consensus AATGGTGAAGGTGATGTTAAATTGCAGAGAAAAATGCAGGTAAAAAGAGTGCAAAAGTGT
 
. : . : . : . : . : . :
JMFS061E12- GTTGAGACACTAGATATGTTAAAGATCAAGAACTCATTGCCAAATAGCAGCAGTGATGAT
rJMSF051H17+ GTTGAGNCACTAGATATGNTAAAGATCAAGAANTCATTGCCAAATAGCAGCAGTGATGAT
                      ____________________________________________________________
consensus GTTGAGACACTAGATATGTTAAAGATCAAGAACTCATTGCCAAATAGCAGCAGTGATGAT
 
. : . : . : . : . : . :
JMFS061E12- CAGGCTAATAGTCCATTGCCTGCAAGCAATGGGAATCACATTCAGAAACACCAATCACCC
rJMFF032B12+ AATAGTCCATTGCCTGCAAGCAATGGGAATCACATTCAGAAACNCCAATCACCC
rJMSF051H17+ CAGGNTAATAGTCCATTGCCTGCAAGCAATGGGAATCACATTCAGAAACANCAATCACCC
                      ____________________________________________________________
consensus CAGGCTAATAGTCCATTGCCTGCAAGCAATGGGAATCACATTCAGAAACACCAATCACCC
 
. : . : . : . : . : . :
JMFS061E12- TCTCCATCTCCAGCTAAACAGCAGCAGCATCATCAACACCGGTATTCATACGACTTGATT
rJMFF032B12+ TTTCCATTTNCAGGTNAACAGCAGCAGCATNATNAACCCCGGTNTTNATNCGNCTTGATT
rJMFF031F04+ AACAGCAGCAGCATNATCAACNCCGGTATTNATNCGNCTTGATT
rJMSF051H17+ TCTNCATNTCCAGCTAAACAGCAGCAGCATCATCAACACCGGTATTCATANGACTTGATT
                      ____________________________________________________________
consensus TCTCCATTTCCAGCTAAACAGCAGCAGCATCATCAACACCGGTATTCATACGACTTGATT
 
. : . : . : . : . : . :
JMFS061E12- TCATTGCCAGTGCACCAGGAGGAGCCGACCGGGGGGCATTCATTCACAAATTCACCTGCA
rJMFF032B12+ TCATTGCCAGTGCNCCAGGAGGAGCCGNCCGGGGGGCATTCATTNNCAAATTCNCCTGCA
rJMFF031F04+ TCATTGCCAGTGCNCCAGGAGGANCCGNCCGGGGGGCATTCATTNACAAATTCNCCTGCA
rJMSF051H17+ TCATNGCCAGTGCACCAGGAGGAGCCGACCGGGGGGCATTCATTCACAAATTCACCTGCA
                      ____________________________________________________________
consensus TCATTGCCAGTGCACCAGGAGGAGCCGACCGGGGGGCATTCATTCACAAATTCACCTGCA
 
. : . : . : . : . : . :
JMFS061E12- AAAACTCCACAGCAACAGCAGCAGCCATCGAGGCGCTCGGCCTCAGGATCAGTGGTGATA
rJMFF032B12+ AAAACTNCNCAGCAACAGCAGCAGCCATTGAGGNGNTTGGCCTCAGGATCAGTGGNGATA
rJMFF031F04+ AAAACTNCNCAGCAACAGCAGCANCCATTGAGGNGNTNGGCCTCAGGATCAGTGGTGATN
rJMSF051H17+ AAAACTNCACAGCAACAGCAGCAGCCATCGNGGCGCTCGGCCTCAGGATCAGTGGTGATA
                      ____________________________________________________________
consensus AAAACTCCACAGCAACAGCAGCAGCCATCGAGGCGCTCGGCCTCAGGATCAGTGGTGATA
 
. : . : . : . : . : . :
JMFS061E12- ACCACGCAATGGGAGACGTTCGATTCCGCTCCAGCGCCCTTGCTGGATCACTTTTCAACC
rJMFF032B12+ ACCNCGCAATGGGNGACGTTTGATTNCGNTCCAGNGCCCTTGGTGGATCNCTTTTCAACC
rJMFF031F04+ ACCNCGCAATGGGAGACGTTTGATTNCGNTCCAGCGCCCTTGNTGGATCACTTTTNAACC
rJMSF051H17+ ACCANGCAATGGGAGACGTTNGATTNCGCTCCAGCGCCCTTGATGGATCACTTTTCAACC
                      ____________________________________________________________
consensus ACCACGCAATGGGAGACGTTTGATTCCGCTCCAGCGCCCTTGGTGGATCACTTTTCAACC
 
. : . : . : . : . : . :
JMFS061E12- CC
rJMFF032B12+ CCCNCTGNGAGTTTGNCCAATCCTAGGNTCAANTGGGNCTTGCTTTAATTTGAGTATATA
rJMFF031F04+ CCCNCTGNGAGTTTGNCCAATCCTAGGNTCAACTGGGNCTTNCCTTAATTTGAGTATATA
rJMSF051H17+ CCCANTGAGAGTTCGACCAATCCTAGGCTCAACTGGGACTTGCTNNAATTTGAGTATATA
                      ____________________________________________________________
consensus CCCACTGAGAGTTTGACCAATCCTAGGCTCAACTGGGACTTGCTTTAATTTGAGTATATA
 
. : . : . : . : . : . :
rJMFF032B12+ TGCAAANCTGCAGAGTGAAGAA
rJMFF031F04+ TGCAAAGCTGCAGAGTGAAGAAGCTGTGCTAGNTG-CTGTGTGCANGTGTGTGTTGCANG
rJMSF051H17+ TGCAAAGCTGCAGAGTGAAGAAGCTGTGCTAGCTGTCTGTGTGCATGTGTGTGTTGCNTG
                      ____________________________________________________________
consensus TGCAAAGCTGCAGAGTGAAGAAGCTGTGCTAGCTGTCTGTGTGCATGTGTGTGTTGCATG
 
. : . : . : . : . : . :
rJMFF031F04+ TTAGTTGTGNTGGTTTG
rJMSF051H17+ TTAGTTGTGNTGGTTTGCTGCTATCCATTCCCCATTNTTTTCNTGTATTTATAGGGTTTT
                      ____________________________________________________________
consensus TTAGTTGTGNTGGTTTGCTGCTATCCATTCCCCATTNTTTTCNTGTATTTATAGGGTTTT