Previous Contig 013942:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039A01Sequence690007257 (2)pir|F85088|F850885e-16hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15880013942 (2)pir|F85088|F85088e-114hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15
JMSF051G23Sequence546007257 (2)pir|F85088|F850882e-05hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15650013942 (2)pir|F85088|F850882e-77hypothetical protein AT4g08810 [imported] - Arabidopsis thaliana>gb:ATCHRIV24_15

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039A01+ GATTTTGAGCACTTGAAAGAGGCGGTACCGATTGTTG
                      ____________________________________________________________
consensus GATTTTGAGCACTTGAAAGAGGCGGTACCGATTGTTG
 
. : . : . : . : . : . :
rJMSF039A01+ AAGAAGGAGATTTCGTTAAGGATTGGAGGAGATGGGATAAGACGCACAAGAAGAACAAAA
                      ____________________________________________________________
consensus AAGAAGGAGATTTCGTTAAGGATTGGAGGAGATGGGATAAGACGCACAAGAAGAACAAAA
 
. : . : . : . : . : . :
rJMSF039A01+ TCCCCGTAAGAAAGGTCAGAGATTATAAAGTCACGCCAATGCAACTCAGGAAAGACAAGA
                      ____________________________________________________________
consensus TCCCCGTAAGAAAGGTCAGAGATTATAAAGTCACGCCAATGCAACTCAGGAAAGACAAGA
 
. : . : . : . : . : . :
rJMSF039A01+ GCACGATTATCTGGAGGCAATTCGATGCTCCCGAGCCTGAAAACTATTGGTACAGAGTCT
                      ____________________________________________________________
consensus GCACGATTATCTGGAGGCAATTCGATGCTCCCGAGCCTGAAAACTATTGGTACAGAGTCT
 
. : . : . : . : . : . :
rJMSF039A01+ GCGAAGGCTCCTCAGCAAAGTACATCCAGAGGCCATGGCATGCTTTGTGGAAATCCAAAC
rJMSF051G23+ CTCAGCAAAGTACATCCAGAGGCCATGGCATGCTTTGTGGAAATCCAAAC
                      ____________________________________________________________
consensus GCGAAGGCTCCTCAGCAAAGTACATCCAGAGGCCATGGCATGCTTTGTGGAAATCCAAAC
 
. : . : . : . : . : . :
rJMSF039A01+ GACTAATGAATATAGTTTCTGCAATAAGTGGGGATATGGACTGGGACTTCGATGCTGCTC
rJMSF051G23+ GACTAATGAATATAGTTTCTGCAATAAGTGGGGATATGGACTGGGACTTCGATGCTGCTC
                      ____________________________________________________________
consensus GACTAATGAATATAGTTTCTGCAATAAGTGGGGATATGGACTGGGACTTCGATGCTGCTC
 
. : . : . : . : . : . :
rJMSF039A01+ ACGTGGTTCGAGGAGAGAAAGCGGAGAACAAGCAGTTATGGCCCCATCTCGATGCTGATA
rJMSF051G23+ ACGTGGTTCGAGGAGAGAAAGCGGAGAACAAGCAGTTATGGCCCCATCTCGATGCTGATA
                      ____________________________________________________________
consensus ACGTGGTTCGAGGAGAGAAAGCGGAGAACAAGCAGTTATGGCCCCATCTCGATGCTGATA
 
. : . : . : . : . : . :
rJMSF039A01+ CATCCCCAGATGCCCTTGTTGCGAAGATTCAAGGGATGATAAAACCCGGAAGGCGTCTTT
rJMSF051G23+ CATCCCCAGATGCCCTTGTTGCGAAGATTCAAGGGATGATAAAACCCGGAAGGCGTCTTT
                      ____________________________________________________________
consensus CATCCCCAGATGCCCTTGTTGCGAAGATTCAAGGGATGATAAAACCCGGAAGGCGTCTTT
 
. : . : . : . : . : . :
rJMSF039A01+ ATATAGCCACAAATGAACCATTTTACAATTATTTCGATAAACTGAGACCTCACTACAAAG
rJMSF051G23+ ATATAGCCACAAATGAACCATTTTACAATTATTTCGATAAACTGAGACCTCACTACAAAG
                      ____________________________________________________________
consensus ATATAGCCACAAATGAACCATTTTACAATTATTTCGATAAACTGAGACCTCACTACAAAG
 
. : . : . : . : . : . :
rJMSF039A01+ TTCACTTGCTCGACGATTACAAGCATCTCTGGAGTAATGTTAGTGAATGGTACAACGAAA
rJMSF051G23+ TTCACTTGCTCGACGATTACAAGCATCTCTGGAGTAATGTTAGTGAATGGTACAACGAAA
                      ____________________________________________________________
consensus TTCACTTGCTCGACGATTACAAGCATCTCTGGAGTAATGTTAGTGAATGGTACAACGAAA
 
. : . : . : . : . : . :
rJMSF039A01+ CAACACTACTGAACGGTGGGCAGCCTGTTGATTTTGATGGATACATGAGGGTCGAAGTGG
rJMSF051G23+ CAACACTACTGAACGGTGGGCAGCCTGTTGATTTTGATGGATACATGAGGGTCGAAGTGG
                      ____________________________________________________________
consensus CAACACTACTGAACGGTGGGCAGCCTGTTGATTTTGATGGATACATGAGGGTCGAAGTGG
 
. : . : . : . : . : . :
rJMSF039A01+ ACACCGAGGTTCTTTACAGGTCCAAGATACGGGTAGAGACATTTTATAACTTGACCAACG
rJMSF051G23+ ACACCGAGGTTCTTTACAGGTCCAAGATACGGGTAGAGACATTTTATAACTTGACCAACG
                      ____________________________________________________________
consensus ACACCGAGGTTCTTTACAGGTCCAAGATACGGGTAGAGACATTTTATAACTTGACCAACG
 
. : . : . : . : . : . :
rJMSF039A01+ ATTGCAAAGATGGAGTTAACACATGCTAGC
rJMSF051G23+ ATTGCAAAGATGGAGTTAACACATGCTAGCCAGGTTCGAGATACCTTTTTTCTGCACTTT
                      ____________________________________________________________
consensus ATTGCAAAGATGGAGTTAACACATGCTAGCCAGGTTCGAGATACCTTTTTTCTGCACTTT
 
. : . : . : . : . : . :
rJMSF051G23+ ACATGTGTGAATTCACATATCATTTTGCTCGCTTCTTACATTTAGTTTTGAAATGAAATT
                      ____________________________________________________________
consensus ACATGTGTGAATTCACATATCATTTTGCTCGCTTCTTACATTTAGTTTTGAAATGAAATT
 
. : . : . : . : . : . :
rJMSF051G23+ GTTGAAGGTTTTGCTGTGGTTTGTTCATTGATCGCATCGATACCAGGCCCCCCCATGTAC
                      ____________________________________________________________
consensus GTTGAAGGTTTTGCTGTGGTTTGTTCATTGATCGCATCGATACCAGGCCCCCCCATGTAC