Previous Contig 013939:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026M10Sequence703019445pir|T09708|T09708e-106glucose-1-phosphate adenylyltransferase (EC 2.7.7.27) small chain (clone psTL2) 764013939 (3)pir|T09708|T09708e-112glucose-1-phosphate adenylyltransferase (EC 2.7.7.27) small chain (clone psTL2)
JMSF051F24Sequence646013939 (3)pir|T09708|T09708e-117glucose-1-phosphate adenylyltransferase (EC 2.7.7.27) small chain (clone psTL2) 742013939 (3)pir|T09708|T09708e-107glucose-1-phosphate adenylyltransferase (EC 2.7.7.27) small chain (clone psTL2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051F24- GGACAGT
                      ____________________________________________________________
consensus GGACAGT
 
. : . : . : . : . : . :
JMSF051F24- TGAAAGCTATGAAGGTTGATACTACTATTTTAGGTCTTGATGATCAGAGAGCTAAAGAGT
                      ____________________________________________________________
consensus TGAAAGCTATGAAGGTTGATACTACTATTTTAGGTCTTGATGATCAGAGAGCTAAAGAGT
 
. : . : . : . : . : . :
JMSF051F24- TGCCTTTTATTGCAAGTATGGGTATATATGTCATTAGCAAAAATGTGATGATAAACCTAC
                      ____________________________________________________________
consensus TGCCTTTTATTGCAAGTATGGGTATATATGTCATTAGCAAAAATGTGATGATAAACCTAC
 
. : . : . : . : . : . :
JMSF051F24- TTCGAGAAAAGTTCCCTGGAGCCAATGACTTTGGAAGTGAAGTCATTCCTGGTGCAACAT
rJMSF026M10+ AGTTCCCTGGAGCCAATGACTTTGGAAGTGAAGTCATTCCTGGTGCAACAT
rJMSF051F24+ GAAGTCATTCCTGGTGCAACAT
                      ____________________________________________________________
consensus TTCGAGAAAAGTTCCCTGGAGCCAATGACTTTGGAAGTGAAGTCATTCCTGGTGCAACAT
 
. : . : . : . : . : . :
JMSF051F24- CCATTGGAATGAGAGTGCAAGCTTATTTGTTTGATGGCTACTGGGAAGATATTGGTACAA
rJMSF026M10+ CCATTGGAATGAGAGTGCAAGCTTATTTGTTTGATGGCTACTGGGAAGATATTGGTACAA
rJMSF051F24+ CCATTGGAATGAGAGTGCAAGCTTATTTGTTTGATGGCTACTGGGAAGATATTGGTACAA
                      ____________________________________________________________
consensus CCATTGGAATGAGAGTGCAAGCTTATTTGTTTGATGGCTACTGGGAAGATATTGGTACAA
 
. : . : . : . : . : . :
JMSF051F24- TTGAGGCTTTCTATAATGCCAACTTGGGGATCACAAAAAAGCCAGTGCCAGATTTCAGTT
rJMSF026M10+ TTGAGGCTTTCTATAATGCCAACTTGGGGATCACAAAAAAGCCAGTGCCAGATTTCAGTT
rJMSF051F24+ TTGAGGCTTTCTATAATGCCAACTTGGGGATCACAAAAAAGCCAGTGCCAGATTTCAGTT
                      ____________________________________________________________
consensus TTGAGGCTTTCTATAATGCCAACTTGGGGATCACAAAAAAGCCAGTGCCAGATTTCAGTT
 
. : . : . : . : . : . :
JMSF051F24- TCTATGACCGATCAGCTCCAATCTACACTCAGCCTCGATATTTACCTCCTTCTAAAATGC
rJMSF026M10+ TCTATGACCGATCAGCTCCAATCTACACTCAGCCTCGATATTTACCTCCTTCTAAAATGC
rJMSF051F24+ TCTATGACCGATCAGCTCCAATCTACACTCAGCCTCGATATTTACCTCCTTCTAAAATGC
                      ____________________________________________________________
consensus TCTATGACCGATCAGCTCCAATCTACACTCAGCCTCGATATTTACCTCCTTCTAAAATGC
 
. : . : . : . : . : . :
JMSF051F24- TTGATGCTGATGTCACGGACAGTGTTATTGGCGAAGGTTGTGTGATCAAGAACTGTAAAA
rJMSF026M10+ TTGATGCTGATGTCACGGACAGTGTTATTGGCGAAGGTTGTGTGATCAAGAACTGTAAAA
rJMSF051F24+ TTGATGCTGATGTCACGGACAGTGTTATTGGCGAAGGTTGTGTGATCAAGAACTGTAAAA
                      ____________________________________________________________
consensus TTGATGCTGATGTCACGGACAGTGTTATTGGCGAAGGTTGTGTGATCAAGAACTGTAAAA
 
. : . : . : . : . : . :
JMSF051F24- TTCACCATTCTGTGATTGGGCTTAGATCGTGTATATCAGAAGGTGCAATTATTGAAGATT
rJMSF026M10+ TTCACCATTCTGTGATTGGGCTTAGATCGTGTATATCAGAAGGTGCAATTATTGAAGATT
rJMSF051F24+ TTCACCATTCTGTGATTGGGCTTAGATCGTGTATATCAGAAGGTGCAATTATTGAAGATT
                      ____________________________________________________________
consensus TTCACCATTCTGTGATTGGGCTTAGATCGTGTATATCAGAAGGTGCAATTATTGAAGATT
 
. : . : . : . : . : . :
JMSF051F24- CACTACTGATGGGAGCTGATTACTATGAGACTGATGCTGACAGGAGGCTTCTGGCAGCAA
rJMSF026M10+ CACTACTGATGGGAGCTGATTACTATGAGACTGATGCTGACAGGAGGCTTCTGGCAGCAA
rJMSF051F24+ CACTACTGATGGGAGCTGATTACTATGAGACTGATGCTGACAGGAGGCTTCTGGCAGCAA
                      ____________________________________________________________
consensus CACTACTGATGGGAGCTGATTACTATGAGACTGATGCTGACAGGAGGCTTCTGGCAGCAA
 
. : . : . : . : . : . :
JMSF051F24- AGGGCAGCATCCCAATTGGCATTGGCAGGAACTCCCACATTAAAAGAGCAATCATTGACA
rJMSF026M10+ AGGGCAGCATCCCAATTGGCATTGGCAGGAACTCCCACATTAAAAGAGCAATCATTGACA
rJMSF051F24+ AGGGCAGCATCCCAATTGGCATTGGCAGGAACTCCCACATTAAAAGAGCAATCATTGACA
                      ____________________________________________________________
consensus AGGGCAGCATCCCAATTGGCATTGGCAGGAACTCCCACATTAAAAGAGCAATCATTGACA
 
. : . : . : . : . : . :
JMSF051F24- AGAATGCCCGTATAGGGGACAATGTGAAGATCATTAA
rJMSF026M10+ AGAATGCCCGTATAGGGGACAATGTGAAGATCATTAATAGTGACGATGTTCAAGAAGCTG
rJMSF051F24+ AGAATGCCCGTATAGGGGACAATGTGAAGATCATTAATAGTGACGATGTTCAAGAAGCTG
                      ____________________________________________________________
consensus AGAATGCCCGTATAGGGGACAATGTGAAGATCATTAATAGTGACGATGTTCAAGAAGCTG
 
. : . : . : . : . : . :
rJMSF026M10+ CTAGGGAAACTGATGGATATTTCATCAAGAGTGGAATCGTCACTGTGATCAAGGATGCAT
rJMSF051F24+ CTAGGGAAACTGATGGATATTTCATCAAGAGTGGAATCGTCACTGTGATCAAGGATGCAT
                      ____________________________________________________________
consensus CTAGGGAAACTGATGGATATTTCATCAAGAGTGGAATCGTCACTGTGATCAAGGATGCAT
 
. : . : . : . : . : . :
rJMSF026M10+ TGATCCCCAG
rJMSF051F24+ TGATCCCCAGCGGGACTGTAATATAAAGATGTAACAAGAGTTGAGGCACATGCATATCCT
                      ____________________________________________________________
consensus TGATCCCCAGCGGGACTGTAATATAAAGATGTAACAAGAGTTGAGGCACATGCATATCCT
 
. : . : . : . : . : . :
rJMSF051F24+ CCAAACTGTTTAGCAGAAGATGGAGCTGCAGTGGTAGTTGTTTATTTTTCCGTAGAAAAT
                      ____________________________________________________________
consensus CCAAACTGTTTAGCAGAAGATGGAGCTGCAGTGGTAGTTGTTTATTTTTCCGTAGAAAAT
 
. : . : . : . : . : . :
rJMSF051F24+ CTAACATTTTTTGTTGGTAATGTTATGTGTCCCATAAGAGAAACTAATGCATATTATCCT
                      ____________________________________________________________
consensus CTAACATTTTTTGTTGGTAATGTTATGTGTCCCATAAGAGAAACTAATGCATATTATCCT