Previous Contig 013935:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN031I14Sequence597013935 (10)gb:AF104396_17682587e-22Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.
JMSF023L19Sequence679013935 (10)gb:AF104396_17682589e-22Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.679013935 (10)gb:AF104396_17682589e-22Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.
JMSF030H24Sequence672013935 (10)gb:AF104396_17682589e-22Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.618013935 (10)gb:AF104396_17682585e-21Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.
JMSF033N06Sequence679013935 (10)gb:AF104396_17682589e-22Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.687013935 (10)gb:AF104396_17682581e-21Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.
JMSF051C08Sequence677010031 (2)gb:AY463620_16077092e-95Arabidopsis thaliana TAF5 (At5g25150) mRNA, complete cds.730013935 (10)gb:AF104396_17682581e-21Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.
JMSF051F04Sequence679013935 (10)gb:AF104396_17682589e-22Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.704013935 (10)gb:AF104396_17682581e-21Cucumis sativus ribosome-like protein (rpo1) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030H24- GAGAGCCTCTAGC
                      ____________________________________________________________
consensus GAGAGCCTCTAGC
 
. : . : . : . : . : . :
JMFN031I14- AGTTTTCAGAAATGGCTGCATCTTCCATAGCCACTCTCTTCTCCTTCTTCTCC
JMSF030H24- CATTTCCAGTTTTCAGAAATGGCTGCATCTTCCATAGCCACTCTCTTCTCCTTCTTCTCC
rJMSF023L19+ TTTTCAGAAATGGCTGCATCTTCCATAGCCACTCTCTTCTCCTTTTTCTCC
JMSF051F04- AGTTTTCAGAAATGGCTGCATCTTCCATAGCCACTCTCTTCTCCTTCTTCTCC
JMSF033N06- AGTTTTCAGAAATGGCTGCATCTTCCATAGCCACTCTCTTCTCCTTCTTCTCC
JMSF023L19- TTTTCAGAAATGGCTGCATCTTCCATAGCCACTCTCTTCTCCTTCTTCTCC
rJMSF051C08+ TCC
                      ____________________________________________________________
consensus CATTTCCAGTTTTCAGAAATGGCTGCATCTTCCATAGCCACTCTCTTCTCCTTCTTCTCC
 
. : . : . : . : . : . :
JMFN031I14- CCCTCCAAACCGCCATCCCCTAAAGCTCCTCCGCTTCAGCTGTCTCTCTCCTCCGACTAT
JMSF030H24- CCCTCCAAACCGCCATCCCCTAAAGCTCCTCCGCTTCAGCTGTCTCTCTCCTCCGACTAT
rJMSF023L19+ CCCTCCAAACCGCCATCCCCTAAAGCTCCTCCGCTTCAGCTGTCTCTCTCCTCCGACTAT
JMSF051F04- CCCTCCAAACCGCCATCCCCTAAAGCTCCTCCGCTTCAGCTGTCTCTCTCCTCCGACTAT
JMSF033N06- CCCTCCAAACCGCCATCCCCTAAAGCTCCTCCGCTTCAGCTGTCTCTCTCCTCCGACTAT
JMSF023L19- CCCTCCAAACCGCCATCCCCTAAAGCTCCTCCGCTTCAGCTGTCTCTCTCCTCCGACTAT
rJMSF033N06+ TCCAAACCGCCATCCCCTAAAGCTCCTCCGCTTCAGCTGTCTCTCTCCTCCGACTAT
rJMSF051C08+ CCCTCCAAACCGCCATCCCCTAAAGCTCCTCCGCTTCAGCTGTCTCTCTCCTCCGACTAT
                      ____________________________________________________________
consensus CCCTCCAAACCGCCATCCCCTAAAGCTCCTCCGCTTCAGCTGTCTCTCTCCTCCGACTAT
 
. : . : . : . : . : . :
JMFN031I14- TCCTCTTCTATCTCGAAAAGCCACAACGATGGTTGGGCCCCGCTAGTGAAAACCGCCGAT
JMSF030H24- TCCTCTTCTATCTCGAAAAGCCACAACGATGGTTGGGCCCCGCTAGTGAAAACCGCCGAT
rJMSF023L19+ TCCTCTTCTATCTCGAAAAGCCACAACGATGGTTGGGCCCCGCTAGTGAAAACCGCCGAT
JMSF051F04- TCCTCTTCTATCTCGAAAAGCCACAACGATGGTTGGGCCCCGCTAGTGAAAACCGCCGAT
JMSF033N06- TCCTCTTCTATCTCGAAAAGCCACAACGATGGTTGGGCCCCGCTAGTGAAAACCGCCGAT
JMSF023L19- TCCTCTTCTATCTCGAAAAGCCACAACGATGGTTGGGCCCCGCTAGTGAAAACCGCCGAT
rJMSF033N06+ TCCTCTTCTATCTCGAAAAGCCACAACGATGGTTGGGCCCCGCTAGTGAAAACCGCCGAT
rJMSF051C08+ TCCTCTTCTATCTCGAAAAGCCACAACGATGGTTGGGCCCCGCTAGTGAAAACCGCCGAT
rJMSF051F04+ AAAAGCCACAACGATGGTTGGGCCCCGCTAGTGAAAACCGCCGAT
                      ____________________________________________________________
consensus TCCTCTTCTATCTCGAAAAGCCACAACGATGGTTGGGCCCCGCTAGTGAAAACCGCCGAT
 
. : . : . : . : . : . :
JMFN031I14- AACCAACAGCAGTATCCATCGCCGCTATCCGGCAATTCCGAGCTCATGTCCGTCGTCTGC
JMSF030H24- AACCAACAGCAGTATCCATCGCCGCTATCCGGCAATTCCGAGCTCATGTCCGTCGTCTGC
rJMSF023L19+ AACCAACAGCAGTATCCATCGCCGCTATCCGGCAATTCCGAGCTCATGTCCGTCGTCTGC
JMSF051F04- AACCAACAGCAGTATCCATCGCCGCTATCCGGCAATTCCGAGCTCATGTCCGTCGTCTGC
JMSF033N06- AACCAACAGCAGTATCCATCGCCGCTATCCGGCAATTCCGAGCTCATGTCCGTCGTCTGC
JMSF023L19- AACCAACAGCAGTATCCATCGCCGCTATCCGGCAATTCCGAGCTCATGTCCGTCGTCTGC
rJMSF033N06+ AACCAACAGCAGTATCCATCGCCGCTATCCGGCAATTCCGAGCTCATGTCCGTCGTCTGC
rJMSF051C08+ AACCAACAGCAGTATCCATCGCCGCTATCCGGCAATTCCGAGCTCATGTCCGTCGTCTGC
rJMSF030H24+ GCAATTCCGAGCTCATGTCCGTCGTCTGC
rJMSF051F04+ AACCAACAGCAGTATCCATCGCCGCTATCCGGCAATTCCGAGCTCATGTCCGTCGTCTGC
                      ____________________________________________________________
consensus AACCAACAGCAGTATCCATCGCCGCTATCCGGCAATTCCGAGCTCATGTCCGTCGTCTGC
 
. : . : . : . : . : . :
JMFN031I14- CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
JMSF030H24- CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
rJMSF023L19+ CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
JMSF051F04- CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
JMSF033N06- CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
JMSF023L19- CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
rJMSF033N06+ CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
rJMSF051C08+ CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
rJMSF030H24+ CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
rJMSF051F04+ CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
                      ____________________________________________________________
consensus CCGTCTCTGGCGCACGCCAACACCCTCTTCTTCTCTTCCTACAACGTCGAGCTCATTGTG
 
. : . : . : . : . : . :
JMFN031I14- GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
JMSF030H24- GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
rJMSF023L19+ GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
JMSF051F04- GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
JMSF033N06- GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
JMSF023L19- GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
rJMSF033N06+ GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
rJMSF051C08+ GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
rJMSF030H24+ GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
rJMSF051F04+ GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
                      ____________________________________________________________
consensus GATGGGGACGAGCCGGAGGAGCGGTTGCTCAACCGCTTCCGCAGAGAGGTGATGAAAACC
 
. : . : . : . : . : . :
JMFN031I14- GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
JMSF030H24- GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
rJMSF023L19+ GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
JMSF051F04- GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
JMSF033N06- GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
JMSF023L19- GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
rJMSF033N06+ GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
rJMSF051C08+ GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
rJMSF030H24+ GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
rJMSF051F04+ GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
                      ____________________________________________________________
consensus GGACTGATTCAAGAGTGCAAGCGCAGGCGATACTTCGAGAACAAGCAGGAGGAGAAGAAG
 
. : . : . : . : . : . :
JMFN031I14- CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
JMSF030H24- CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
rJMSF023L19+ CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
JMSF051F04- CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
JMSF033N06- CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
JMSF023L19- CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
rJMSF033N06+ CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
rJMSF051C08+ CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
rJMSF030H24+ CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
rJMSF051F04+ CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
                      ____________________________________________________________
consensus CGCAAGTCCCGTGAAGCCGCCAGGCGCAATCGTCGACGACGAAGAGGTCCCTTTGAGGAT
 
. : . : . : . : . : . :
JMFN031I14- AGGCGAATGGCCTCTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
JMSF030H24- AGGCGAATGGCCTCTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
rJMSF023L19+ AGGCGAATGGCCTCTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
JMSF051F04- AGGCGAATGGCCTTTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
JMSF033N06- AGGCGAATGGCCTCTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
JMSF023L19- AGGCGAATGGCCTCTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
rJMSF033N06+ AGGCGAATGGCCTCTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
rJMSF051C08+ AGGCGAATGGCCTCTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
rJMSF030H24+ AGGCGAATGGCCTCTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
rJMSF051F04+ AGGCGAATGGCCTTTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
                      ____________________________________________________________
consensus AGGCGAATGGCCTCTGCAAACAACAATGGCGATGGTAAAAAAGAGGAAGAAGACGACGAC
 
. : . : . : . : . : . :
JMFN031I14- NATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACNAGGATTCT
JMSF030H24- AATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACAAGGATTCT
rJMSF023L19+ AATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACAAGGATTCT
JMSF051F04- NATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACAAGGATTCT
JMSF033N06- NATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACAAGGATTCT
JMSF023L19- NATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACAAGGATTCT
rJMSF033N06+ AATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACAAGGATTCT
rJMSF051C08+ AATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACAAGGATTCT
rJMSF030H24+ AATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACAAGGATTCT
rJMSF051F04+ AATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACAAGGATTCT
                      ____________________________________________________________
consensus AATTGGGAACTTCCCGACAAAGACGTGCCCTTTTGATTGAATTTATTTTACAAGGATTCT
 
. : . : . : . : . : . :
JMFN031I14- GGT
JMSF030H24- GGTTGACTTTGCTTTTGAAGAGGCTTCTTATCCCTGTAAGGNTTCATGTCCTCTAATCT
rJMSF023L19+ GGTTGACTTTGCTTTTGAAGAGGCTTCTTATCCCTGTAAGGTTTCATGTCCTCTAATCTT
JMSF051F04- GGTTGACTTTGCTTTTGAAGANGCTTCTTATCCCTGTAAGGNTTCATGTCCTCTAATCTT
JMSF033N06- GGTTGACTTTGCTTTTGAAGAGGCTTCTTATCCCTGTAAGGTTTCATGTCCTCTAATCTT
JMSF023L19- GGTTGACTTTGCTTTTGAAGAGGCTTCTTATCCCTGTAAGGNTTCATGTCCTCTAATCTT
rJMSF033N06+ GGTTGACTTTGCTTTTGAAGAGGCTTCTTATCCCTGTAAGGTTTCATGTCCTCTAATCTT
rJMSF051C08+ GGTTGACTTTGCTTTTGAAGAGGCTTCTTATCCCTGTAAGGTTTCATGTCCTCTAATCTT
rJMSF030H24+ GGTTGACTTTGCTTTTGAAGAGGCTTCTTATCCCTGTAAGGTTTCATGTCCTCTAATCTT
rJMSF051F04+ GGTTGACTTTGCTTTTGAAGAGGCTTCTTATCCCTGTAAGGTTTCATGTCCTCTAATCTT
                      ____________________________________________________________
consensus GGTTGACTTTGCTTTTGAAGAGGCTTCTTATCCCTGTAAGGTTTCATGTCCTCTAATCTT
 
. : . : . : . : . : . :
rJMSF023L19+ CCCAATGCACTTAACTCTCTCTATT
JMSF051F04- CCCAATGCACTTAACTCTCTCTATT
JMSF033N06- CCCAATGCACTTAACTCTCTCTATT
JMSF023L19- CCCAATGCACTTAACTCTCTCTATT
rJMSF033N06+ CCCAATGCACTTAACTCTCTCTATTTTTCTGTGATTTCTTCTTAATGCACATGTAATTGC
rJMSF051C08+ CCCAATGCACTTAACTCTCTCTATTTTTCTGTGATTTCTTCTTAATGCACATGTAATTGC
rJMSF030H24+ CCCAATGCACTTAACTCTCTCTATTTTTCTGTGATTTCTTCTTAATGCACATGTAATTGC
rJMSF051F04+ CCCAATGCACTTAACTCTCTCTATTTTTCTGTGATTTCTTCTTAATGCACATGTAATTGC
                      ____________________________________________________________
consensus CCCAATGCACTTAACTCTCTCTATTTTTCTGTGATTTCTTCTTAATGCACATGTAATTGC
 
. : . : . : . : . : . :
rJMSF033N06+ TTGCTTTTCTTGTTGCTTTCTGAGTTGT
rJMSF051C08+ TTGCTTTTCTTGTTGCTTTCTGAGTTGTTAGACATCATCTAGTATCTTATGTAAAATAGT
rJMSF030H24+ TTGCTTTTCTTGTTGCTTTCTGAGTTGTTAGACATCATCTAGTATCTTATGTAAAATAGT
rJMSF051F04+ TTGCTTTTCTTGTTGCTTTCTGAGTTGTTAGACATCATCTAGTATCTTATGTAAAATAGT
                      ____________________________________________________________
consensus TTGCTTTTCTTGTTGCTTTCTGAGTTGTTAGACATCATCTAGTATCTTATGTAAAATAGT
 
. : . : . : . : . : . :
rJMSF051C08+ TGATGT
rJMSF030H24+ TGATGTTGTAAGTCCATCATAAGACCAATGACCATGATGTTTCATCCTT
rJMSF051F04+ TGATGTTGTAAGTCCATCATAAGACCAATGA-CATGATGTTTCATCCTTACAATGTAAGG
                      ____________________________________________________________
consensus TGATGTTGTAAGTCCATCATAAGACCAATGACCATGATGTTTCATCCTTACAATGTAAGG