Previous Contig 013934:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF051E22Sequence666013934 (2)sp|Q39127|TINY_ARATH1e-37Transcriptional factor TINY.>pir|T01076|T01076 transcription factor TINY - Arabi760013934 (2)pir|T48518|T485182e-37transcription factor like protein - Arabidopsis thaliana>gb:ATF15N18_1548746 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051E22- GGTC
                      ____________________________________________________________
consensus GGTC
 
. : . : . : . : . : . :
JMSF051E22- ATCTCTCATTCTCTCCCCCCTTATTATAAGTGTTGCATGACTCCTAGGGAAGCTCAAGCT
                      ____________________________________________________________
consensus ATCTCTCATTCTCTCCCCCCTTATTATAAGTGTTGCATGACTCCTAGGGAAGCTCAAGCT
 
. : . : . : . : . : . :
JMSF051E22- CAAGCTCAACCTCCCTCATTCATTCATTCTACCACCAACATATTATATATATACACACTT
                      ____________________________________________________________
consensus CAAGCTCAACCTCCCTCATTCATTCATTCTACCACCAACATATTATATATATACACACTT
 
. : . : . : . : . : . :
JMSF051E22- CCATATATCTATATACTCAGGTCTGGGAGTGCATGATATATATATATTTTTGATCCATCT
                      ____________________________________________________________
consensus CCATATATCTATATACTCAGGTCTGGGAGTGCATGATATATATATATTTTTGATCCATCT
 
. : . : . : . : . : . :
JMSF051E22- ATATATATATCACAGTAGAGATCAGATGAGTTCAGACCCACCAGATTGCAGTTCAAGCTC
                      ____________________________________________________________
consensus ATATATATATCACAGTAGAGATCAGATGAGTTCAGACCCACCAGATTGCAGTTCAAGCTC
 
. : . : . : . : . : . :
JMSF051E22- AGAAGTAGCTTGCGAGTCAACTCGGGCGGTTCTTGACTCGGGGTCTGCAGAAAAGGAAGA
                      ____________________________________________________________
consensus AGAAGTAGCTTGCGAGTCAACTCGGGCGGTTCTTGACTCGGGGTCTGCAGAAAAGGAAGA
 
. : . : . : . : . : . :
JMSF051E22- ACCGAAGAAGATGACGATGAAGAGAAGCCGGGATAATAGTTGCAGTAAACATCCGGTGTA
                      ____________________________________________________________
consensus ACCGAAGAAGATGACGATGAAGAGAAGCCGGGATAATAGTTGCAGTAAACATCCGGTGTA
 
. : . : . : . : . : . :
JMSF051E22- CCGGGGAGTTAGTATGAGGAACTGGGGAAAATGGGTTTCCGAAATCCGGGAGCCCCGGAA
rJMSF051E22+ TTCCGAAATCCGGGAGCCCCGGAA
                      ____________________________________________________________
consensus CCGGGGAGTTAGTATGAGGAACTGGGGAAAATGGGTTTCCGAAATCCGGGAGCCCCGGAA
 
. : . : . : . : . : . :
JMSF051E22- GAAATCGCGCATTTGGCTTGGGACCTTCTCTAACCCGGAAATGGCGGCCAGGGCACACGA
rJMSF051E22+ GAAATCGCGCATTTGGCTTGGGACCTTCTCTAACCCGGAAATGGCGGCCAGGGCACACGA
                      ____________________________________________________________
consensus GAAATCGCGCATTTGGCTTGGGACCTTCTCTAACCCGGAAATGGCGGCCAGGGCACACGA
 
. : . : . : . : . : . :
JMSF051E22- CGTCGCCGCTCTGAGCATCAAGGGCAATTCCGCCGTGCTCAATTTCCCCGACCTGGCCGC
rJMSF051E22+ CGTCGCCGCTCTGAGCATCAAGGGCAATTCCGCCGTGCTCAATTTCCCCGACCTGGCCGC
                      ____________________________________________________________
consensus CGTCGCCGCTCTGAGCATCAAGGGCAATTCCGCCGTGCTCAATTTCCCCGACCTGGCCGC
 
. : . : . : . : . : . :
JMSF051E22- CGCGCTGCCCCGCCCGGCGTCGCTCACGCCGCGGGACATTCAAGTGGCTGCCGCTAAAGC
rJMSF051E22+ CGCGCTGCCCCGCCCGGCGTCGCTCACGCCGCGGGACATTCAAGTGGCTGCCGCTAAAGC
                      ____________________________________________________________
consensus CGCGCTGCCCCGCCCGGCGTCGCTCACGCCGCGGGACATTCAAGTGGCTGCCGCTAAAGC
 
. : . : . : . : . : . :
JMSF051E22- GGCGGCGATGGAGAAATTTGACCCCGTATCTTCTCCGTCGCCGTCTCCGTCCTCCTCGTG
rJMSF051E22+ GGCGGCGATGGAGAAATTTGACCCCGTATCTTCTCCGTCGCCGTCTCCGTCCTCCTCGTG
                      ____________________________________________________________
consensus GGCGGCGATGGAGAAATTTGACCCCGTATCTTCTCCGTCGCCGTCTCCGTCCTCCTCGTG
 
. : . : . : . : . : . :
JMSF051E22- TT
rJMSF051E22+ TTCGTCGGAGATAGACCCGGCGACGTCGGAGGAGCTGAGCGAAATCGTGGAGCTGCCGAG
                      ____________________________________________________________
consensus TTCGTCGGAGATAGACCCGGCGACGTCGGAGGAGCTGAGCGAAATCGTGGAGCTGCCGAG
 
. : . : . : . : . : . :
rJMSF051E22+ GCTGGGCACGAGTTTCGACTCGCCCGAGGTGGGGAGCGAGTTCGTGTACGTTGACTCGGT
                      ____________________________________________________________
consensus GCTGGGCACGAGTTTCGACTCGCCCGAGGTGGGGAGCGAGTTCGTGTACGTTGACTCGGT
 
. : . : . : . : . : . :
rJMSF051E22+ GGACGGGTGGCTGTACCCGCCGCCGTGGCTCGGCAGCGGCGCGGACGACGACGATAGTAG
                      ____________________________________________________________
consensus GGACGGGTGGCTGTACCCGCCGCCGTGGCTCGGCAGCGGCGCGGACGACGACGATAGTAG
 
. : . : . : . : . : . :
rJMSF051E22+ CAGTTTTGAGTCTCTGTTATGGAATTATTAGCTTTCGGTCCCTGTGTGAGGTTTTTGTTT
                      ____________________________________________________________
consensus CAGTTTTGAGTCTCTGTTATGGAATTATTAGCTTTCGGTCCCTGTGTGAGGTTTTTGTTT
 
. : . : . : . : . : . :
rJMSF051E22+ TCTCTTTCAACCCTTTTATTTTTGTGTATTTACGTTATCTTAGCCGTTCAAATTTTTGTG
                      ____________________________________________________________
consensus TCTCTTTCAACCCTTTTATTTTTGTGTATTTACGTTATCTTAGCCGTTCAAATTTTTGTG
 
. : . : . : . : . : . :
rJMSF051E22+ TGAAGGGCTTGCAAATTTCACGATTCCTAATTACCTCCCAATATTCTCTCCTCTTGTCTT
                      ____________________________________________________________
consensus TGAAGGGCTTGCAAATTTCACGATTCCTAATTACCTCCCAATATTCTCTCCTCTTGTCTT
 
. : . : . : . : . : . :
rJMSF051E22+ TGTTGGTGTAATGACATCTCTTCCTTCTTATGACAGTCTAACTGCACAGTGTTAGAAAGG
                      ____________________________________________________________
consensus TGTTGGTGTAATGACATCTCTTCCTTCTTATGACAGTCTAACTGCACAGTGTTAGAAAGG
 
. : . : . : . : . : . :
rJMSF051E22+ TTGAGAAAAATGTCATAAATGCATTCCCATGGTTTGGTATATGTATATATTAGTGTGTGG
                      ____________________________________________________________
consensus TTGAGAAAAATGTCATAAATGCATTCCCATGGTTTGGTATATGTATATATTAGTGTGTGG