Previous Contig 013921:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014I06Sequence533013921 (10)sp|O78328|DXS_CAPAN1e-58Probable 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast precursor (EC 2.2.788013921 (10)sp|O78328|DXS_CAPAN7e-81Probable 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast precursor (EC 2.2.
JMSF024C07Sequence694013921 (10)sp|O78328|DXS_CAPAN6e-81Probable 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast precursor (EC 2.2.714013921 (10)sp|O78328|DXS_CAPAN6e-81Probable 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast precursor (EC 2.2.
JMSF033A02Sequence695013921 (10)sp|O78328|DXS_CAPAN6e-81Probable 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast precursor (EC 2.2.654013921 (10)sp|O78328|DXS_CAPAN8e-73Probable 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast precursor (EC 2.2.
JMSF041C17Sequence764013921 (10)sp|O78328|DXS_CAPAN1e-79Probable 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast precursor (EC 2.2.552013921 (10)sp|O78328|DXS_CAPAN2e-73Probable 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast precursor (EC 2.2.
JMSF051C07Sequence648013921 (10)sp|O78328|DXS_CAPAN3e-79Probable 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast precursor (EC 2.2.733013921 (10)sp|O78328|DXS_CAPAN1e-79Probable 1-deoxy-D-xylulose 5-phosphate synthase, chloroplast precursor (EC 2.2.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF014I06- GAGTGAGCCTTGAAT
JMSF051C07- GAGTGAGCCTTGAAT
JMSF024C07- GAGTGAGCCTTGAAT
JMSF033A02- GAGTGAGCCTTGAAT
JMSF041C17- GAGTGAGCCTTGAAT
                      ____________________________________________________________
consensus GAGTGAGCCTTGAAT
 
. : . : . : . : . : . :
JMSF014I06- CTGCACTACCTCACCTCTGCAATTCACACACATACTAGATACTACACTACTGAAAAAAAG
JMSF051C07- CTGCACTACCTCACCTCTGCAATTCACACACATACTAGATACTACACTACTGAAAAAAAG
JMSF024C07- CTGCACTACCTCACCTCTGCAATTCACACACATACTAGATACTACACTACTGAAAAAAAG
JMSF033A02- CTGCACTACCTCACCTCTGCAATTCACACACATACTAGATACTACACTACTGAAAAAAAG
rJMSF024C07+ TCTGCAATTCACACACATACTAGATACTACACTACTGAAAAAAAG
JMSF041C17- CTGCACTACCTCACCTCTGCAATTCACACACATACTAGATACTACACTACTGAAAAAAAG
rJMSF014I06+ TGCAATTCACACACATACTAGATACTACACTACTGAAAAAAAG
                      ____________________________________________________________
consensus CTGCACTACCTCACCTCTGCAATTCACACACATACTAGATACTACACTACTGAAAAAAAG
 
. : . : . : . : . : . :
JMSF014I06- AAATGGCTCTTCCTACATTTGCATTCACTGGCACTTCCAATTCCGCTTATCCCCAAAACC
JMSF051C07- AAATGGCTCTTCCTACATTTGCATTCACTGGCACTTCCAATTCCGCTTATCCCCAAAACC
JMSF024C07- AAATGGCTCTTCCTACATTTGCATTCACTGGCACTTCCAATTCCGCTTATCCCCAAAACC
JMSF033A02- AAATGGCTCTTCCTACATTTGCATTCACTGGCACTTCCAATTCCGCTTATCCCCAAAACC
rJMSF024C07+ AAATGGCTCTTCCTACATTTGCATTCACTGGCACTTCCAATTCCGCTTATCCCCAAAACC
JMSF041C17- AAATGGCTCTTCCTACATTTGCATTCACTGGCACTTCCAATTCCGCTTATCCCC-AAACC
rJMSF014I06+ AAATGGCTCTTCCTACATTTGCATTCACTGGCACTTCCAATTCCGCTTATCCCCAAAACC
rJMSF051C07+ TATCCCCAAAACC
                      ____________________________________________________________
consensus AAATGGCTCTTCCTACATTTGCATTCACTGGCACTTCCAATTCCGCTTATCCCCAAAACC
 
. : . : . : . : . : . :
JMSF014I06- ATGCTGCAGCTTTCTGCTCTTACTGGCTCCATGGAACAGATTTGCAGTTTCACCTCCATT
JMSF051C07- ATGCTGCAGCTTTCTGCTCTTACTGGCTCCATGGAACAGATTTGCAGTTTCACCTCCATT
JMSF024C07- ATGCTGCAGCTTTCTGCTCTTACTGGCTCCATGGAACAGATTTGCAGTTTCACCTCCATT
JMSF033A02- ATGCTGCAGCTTTCTGCTCTTACTGGCTCCATGGAACAGATTTGCAGTTTCACCTCCATT
rJMSF024C07+ ATGCTGCAGCTTTCTGCTCTTACTGGCTCCATGGAACAGATTTGCAGTTTCACCTCCATT
rJMSF041C17+ CATT
JMSF041C17- ATGCTGCAGCTTTCTGCTCTTACTGGCTCCATGGAACAGATTTGCAGTTTCACCTCCATT
rJMSF014I06+ ATGCTGCAGCTTTCTGCTCTTACTGGCTCCATGGAACAGATTTGCAGTTTCACCTCCATT
rJMSF051C07+ NTGCTGCAGCTTTCTGCTCTTACTGGCTCCATGGAACAGATTTGCAGTTTCACCTCCATT
                      ____________________________________________________________
consensus ATGCTGCAGCTTTCTGCTCTTACTGGCTCCATGGAACAGATTTGCAGTTTCACCTCCATT
 
. : . : . : . : . : . :
JMSF014I06- TTAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
JMSF051C07- TTAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
JMSF024C07- TTAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
JMSF033A02- TTAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
rJMSF024C07+ TTAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
rJMSF041C17+ TTAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
JMSF041C17- TTAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
rJMSF014I06+ TTAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
rJMSF033A02+ TAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
rJMSF051C07+ TTAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
                      ____________________________________________________________
consensus TTAAACCCACCCAGGTGAAGAAGAGATCAAGTGGGATTCAGGCAGTAGTGACAGAGAAAG
 
. : . : . : . : . : . :
JMSF014I06- GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
JMSF051C07- GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
JMSF024C07- GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
JMSF033A02- GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
rJMSF024C07+ GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
rJMSF041C17+ GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
JMSF041C17- GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
rJMSF014I06+ GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
rJMSF033A02+ GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
rJMSF051C07+ GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
                      ____________________________________________________________
consensus GGATGTATTACTCACAGAGGCCACCAACTCCACTTTTGGACACCATTAACTATCCAATTC
 
. : . : . : . : . : . :
JMSF014I06- ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
JMSF051C07- ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
JMSF024C07- ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
JMSF033A02- ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
rJMSF024C07+ ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
rJMSF041C17+ ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
JMSF041C17- ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
rJMSF014I06+ ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
rJMSF033A02+ ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
rJMSF051C07+ ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
                      ____________________________________________________________
consensus ACATGAAAAATCTGTCGGTGAAGGAACTGGAGCAACTTGCTGATGAGATAAGGTCTGATA
 
. : . : . : . : . : . :
JMSF014I06- CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
JMSF051C07- CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
JMSF024C07- CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
JMSF033A02- CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
rJMSF024C07+ CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
rJMSF041C17+ CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
JMSF041C17- CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
rJMSF014I06+ CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
rJMSF033A02+ CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
rJMSF051C07+ CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
                      ____________________________________________________________
consensus CGATATTTAATGTTTCAAAGACGGGGGGTCATCTTGGCTCCAACCTGGGTGTTGTGGAGC
 
. : . : . : . : . : . :
JMSF014I06- TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
JMSF051C07- TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
JMSF024C07- TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
JMSF033A02- TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
rJMSF024C07+ TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
rJMSF041C17+ TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
JMSF041C17- TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
rJMSF014I06+ TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
rJMSF033A02+ TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
rJMSF051C07+ TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
                      ____________________________________________________________
consensus TCACAGTAGCACTTCATTATGTGTTCAACACACCGCAGGATAAGATTCTGTGGGATGTGG
 
. : . : . : . : . : . :
JMSF014I06- GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGA
JMSF051C07- GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGAAGGGGGAAGATGTCGACACTGA
JMSF024C07- GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGAAGGGGGAAGATGTCGACACTGA
JMSF033A02- GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGAAGGGGGAAGATGTCGACACTGA
rJMSF024C07+ GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGAAGGGGGAAGATGTCGACACTGA
rJMSF041C17+ GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGAAGGGGGAAGATGTCGACACTGA
JMSF041C17- GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGAAGGGGGAAGATGTCGACACTGA
rJMSF014I06+ GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGAAGGGGGAAGATGTCGACACTGA
rJMSF033A02+ GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGAAGGGGGAAGATGTCGACACTGA
rJMSF051C07+ GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGAAGGGGGAAGATGTCGACACTGA
                      ____________________________________________________________
consensus GTCATCAGTCCTACCCTCATAAAATTTTGACGGGTAGAAGGGGGAAGATGTCGACACTGA
 
. : . : . : . : . : . :
JMSF051C07- GACAGACAAATGGGCTTTCTGGATTTACCAAGCGTTCAGAGAGCGACCATGATTGCTTTG
JMSF024C07- GACAGACAAATGGGCTTTCTGGATTTACCAAGCGTTCAGAGAGCGACCATGATTGCTTTG
JMSF033A02- GACAGACAAATGGGCTTTCTGGATTTACCAAGCGTTCAGAGAGCGACCATGATTGCTTTG
rJMSF024C07+ GACAGACAAATGGGCTTTCTGGATTTACCAAGCGTTCAGAGAGCGACCATGATTGCTTTG
rJMSF041C17+ GACAGACAAATGGGCTTTCTGGATTTACCAAGCGTTCAGAGAGCGACCATGATTGCTTTG
JMSF041C17- GACAGACAAATGGGCTTTCTGGATTTACCAAGCGTTCAGAGAGCGACCATGATTGCTTTG
rJMSF014I06+ GACAGACAAATGGGCTTTCTGGATTTACCAAGCGTTCAGAGAGCGACCATGATTGCTTTG
rJMSF033A02+ GACAGACAAATGGGCTTTCTGGATTTACCAAGCGTTCAGAGAGCGACCATGATTGCTTTG
rJMSF051C07+ GACAGACAAATGGGCTTTCTGGATTTACCAAGCGTTCAGAGAGCGACCATGATTGCTTTG
                      ____________________________________________________________
consensus GACAGACAAATGGGCTTTCTGGATTTACCAAGCGTTCAGAGAGCGACCATGATTGCTTTG
 
. : . : . : . : . : . :
JMSF051C07- GTACCGGCCACAGTTCAACCACTATCTCAGCTG
JMSF024C07- GTACCGGCCACAGTTCAACCACTATCTCAGCTGGATTAGGTAATTTTTTATGACAAATTA
JMSF033A02- GTACCGGCCACAGTTCAACCACTATCTCAGCTGGATTAGGTAATTTTTTATGACAAATTA
rJMSF024C07+ GTACCGGCCACAGTTCAACCACTATCTCAGCTGGATTAGGTAATTTTTTATGACAAATTA
rJMSF041C17+ GTACCGGCCACAGTTCAACCACTATCTCAGCTGGATTAGGTAATTTTTTATGACAAATTA
JMSF041C17- GTACCGGCCACAGTTCAACCACTATCTCAGCTGGATTAGGTAATTTTTTATGACAAATTA
rJMSF014I06+ GTACCGGCCACAGTTCAACCACTATCTCAGCTGGATTAGGTAATTTTTTATGACAAATTA
rJMSF033A02+ GTACCGGCCACAGTTCAACCACTATCTCAGCTGGATTAGGTAATTTTTTATGACAAATTA
rJMSF051C07+ GTACCGGCCACAGTTCAACCACTATCTCAGCTGGATTAGGTAATTTTTTATGACAAATTA
                      ____________________________________________________________
consensus GTACCGGCCACAGTTCAACCACTATCTCAGCTGGATTAGGTAATTTTTTATGACAAATTA
 
. : . : . : . : . : . :
JMSF024C07- TTGTACGTAATGCGGTCCG
JMSF033A02- TTGTACGTAATGCGGTCCGA
rJMSF024C07+ TTGTACGTAATGCGGTCCGAAACAATATCGTTTTGATGTTTAAAAAAAATATTTCTTGTT
rJMSF041C17+ TTGTACGTAATGCGGTCCGAAACAATATCGTTTTGATGTTTAAAAAAAATATTTCTTGTT
JMSF041C17- TTGTACGTAATGCGGTCCGAAACAATATCGTTTTGATGTTTAAAAAAAATATTTCTTGTT
rJMSF014I06+ TTGTACGTAATACGGTCCGAAACAATATCGTTTTGATGTTTAAAAAAAATATTTCTTGTT
rJMSF033A02+ TTGTACGTAATGCGGTCCGAAACAATATCGTTTTGATGTTTAAAAAAAATATTTCTTGTT
rJMSF051C07+ TTGTACGTAATGCGGTCCGAAACAATATCGTTTTGATGTTTAAAAAAAATATTTCTTGTT
                      ____________________________________________________________
consensus TTGTACGTAATGCGGTCCGAAACAATATCGTTTTGATGTTTAAAAAAAATATTTCTTGTT
 
. : . : . : . : . : . :
rJMSF024C07+ TCTCGCTTG
rJMSF041C17+ TCTCGCTT
JMSF041C17- TCTCGCTTGTTAGAATAATGAATATTCTGA
rJMSF014I06+ TCTCGCTTGTTAGAATAATGAATATTCTGAGATAAGATAATGCATTTTGAATTAGAATAA
rJMSF033A02+ TCTCGCTTGTTAGAATAATGAATATTCTGAGATAAGATAATGCATTTTGAATTAGAATAA
rJMSF051C07+ TCTCGCTTGTTAGAATAATGAATATTCTGAGATAAGATAATGCATTTTGAATTAGAATAA
                      ____________________________________________________________
consensus TCTCGCTTGTTAGAATAATGAATATTCTGAGATAAGATAATGCATTTTGAATTAGAATAA
 
. : . : . : . : . : . :
rJMSF014I06+ TGTATTTTATGTGTTAGAATAGT
rJMSF033A02+ TGTATTTTATGTGTTAGAATAGTGTATTTTATTTGTGCTATAATAGTGAAGATAA
rJMSF051C07+ TGTATTTTATGTGTTAGAATAGTGTATTTTATTTGTGCTATAATAGTGAAGATAATATTT
                      ____________________________________________________________
consensus TGTATTTTATGTGTTAGAATAGTGTATTTTATTTGTGCTATAATAGTGAAGATAATATTT