Previous Contig 013917:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015C08Sequence490005522 (2)pir|A71425|A714252e-21hypothetical protein - Arabidopsis thaliana>gb:ATCHRIV42_1545394 Arabidopsis tha742013917 (7)gb:BT002983_16365664e-46Arabidopsis thaliana clone RAFL15-19-L01 (R20455) putative cytochrome c oxidored
JMSF016M21Sequence487013917 (7)gb:AB022217_15150731e-31Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6.>gb:BT010528_1640755013917 (7)gb:BT002983_16365664e-46Arabidopsis thaliana clone RAFL15-19-L01 (R20455) putative cytochrome c oxidored
JMSF017K07Sequence513013917 (7)gb:AB022217_15150738e-30Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6.>gb:BT010528_1640732013917 (7)gb:BT002983_16365664e-46Arabidopsis thaliana clone RAFL15-19-L01 (R20455) putative cytochrome c oxidored
JMSF051A16Sequence697013917 (7)gb:BT002983_16365663e-54Arabidopsis thaliana clone RAFL15-19-L01 (R20455) putative cytochrome c oxidored714013917 (7)gb:BT002983_16365662e-34Arabidopsis thaliana clone RAFL15-19-L01 (R20455) putative cytochrome c oxidored

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF016M21- GAAGTGGCTACTTCCCTCCGCTGCTTCACT
JMSF017K07- AAGTGGCTACTTCCCTCCGCTGCTTCACT
JMSF051A16- AAGTGGCTACTTCCCTCCGCTGCTTCACT
                      ____________________________________________________________
consensus GAAGTGGCTACTTCCCTCCGCTGCTTCACT
 
. : . : . : . : . : . :
JMSF016M21- TTCTGTTTTTTCTAATACAGCAATGGATCTAGACTTGAGTTTCTACGTCGGAGTTGTAGG
JMSF017K07- TTCTGTTTTTTCTAATACAGCAATGGATCTAGACTTGAGTTTCTACGTC-GAGTTGTAGG
JMSF051A16- TTCTGTTTTTTCTAATACAGCAATGGATCTAGACTTGAGTTTCTACGTCGGAGTTGTAGG
                      ____________________________________________________________
consensus TTCTGTTTTTTCTAATACAGCAATGGATCTAGACTTGAGTTTCTACGTCGGAGTTGTAGG
 
. : . : . : . : . : . :
JMSF016M21- AAATATCCTCTCCATTTTCATCTTCCTTTCCCCCGCGGATGTATTCATTAGGATAGTGAA
JMSF017K07- AAATATCCTCTCCATTTTCATCTTCCTTTCCCCCGCGGATGTATTCATTAGGATAGTGAA
JMSF051A16- AAATATCCTCTCCATTTTCATCTTCCTTTCCCCCGCGGATGTATTCATTAGGATAGTGAA
rJMSF017K07+ GATGTATTCATTAGGATAGTGAA
rJMSF015C08+ GGATGTATTCATTAGGATAGTGAA
rJMSF016M21+ CGGATGTATTCATTAGGATAGTGAA
                      ____________________________________________________________
consensus AAATATCCTCTCCATTTTCATCTTCCTTTCCCCCGCGGATGTATTCATTAGGATAGTGAA
 
. : . : . : . : . : . :
JMSF016M21- GAACAGATCCACAGAAGACTTCGATAGCATTCCTTACATCTCTACGTTGCTGAGTTCGTC
JMSF017K07- GAACAGATCCACAGAAGACTTCGATAGCATTCCTTACATCTCTACGTTGCTGAGTTCGTC
JMSF051A16- GAACAGATCCACAGAAGACTTCGATAGCATTCCTTACATCTCTACGTTGCTGAGTTCGTC
rJMSF017K07+ GAACAGATCCACAGAAGACTTCGATAGCATTCCTTACATCTCTACGTTGCTGAGTTCGTC
rJMSF015C08+ GAACAGATCCACAGAAGACTTCGATAGCATTCCTTACATCTCTACGTTGCTGAGTTCGTC
rJMSF016M21+ GAACAGATCCACAGAAGACTTCGATAGCATTCCTTACATCTCTACGTTGCTGAGTTCGTC
                      ____________________________________________________________
consensus GAACAGATCCACAGAAGACTTCGATAGCATTCCTTACATCTCTACGTTGCTGAGTTCGTC
 
. : . : . : . : . : . :
JMSF016M21- CCTTTGGTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTCACTGTCAATGC
JMSF017K07- CCTTTGGTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTCACTGTCAATGC
JMSF051A16- CCTTTGGTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTCACTGTCAATGC
rJMSF017K07+ CCTTTGGTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTCACTGTCAATGC
rJMSF015C08+ CCTTTGGTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTCACTGTCAATGC
rJMSF016M21+ CCTTTGGTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTCACTGTCAATGC
rJMSF051A16+ GTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTCACTGTCAATGC
                      ____________________________________________________________
consensus CCTTTGGTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTCACTGTCAATGC
 
. : . : . : . : . : . :
JMSF016M21- TTTCGGCGTTCTGGCCGAGACCGTATACGTCCTCATCTTCATCGTCTTCGCTCCTCCTAA
JMSF017K07- TTTCGGCGTTCTGGCCGAGACCGTATACGTCCTCATCTTCATCGTCTTCGCTCCTCCTAA
JMSF051A16- TTTCGGCGTTCTGGCCGANACCGTATACGTCCTCATCTTCATCGTCTTCGCTCCTCCTAA
rJMSF017K07+ TTTCGGCGTTCTGGCCGAGACCGTATACGTCCTCATCTTCATCGTCTTCGCTCCTCCTAA
rJMSF015C08+ TTTCGGCGTTCTGGCCGAGACCGTATACGTCCTCATCTTCATCGTCTTCGCTCCTCCTAA
rJMSF016M21+ TTTCGGCGTTCTGGCCGAGACCGTATACGTCCTCATCTTCATCGTCTTCGCTCCTCCTAA
rJMSF051A16+ TTTCGGCGTTCTGGCCGAGACCGTATACGTCCTCATCTTCATCGTCTTCGCTCCTCCTAA
                      ____________________________________________________________
consensus TTTCGGCGTTCTGGCCGAGACCGTATACGTCCTCATCTTCATCGTCTTCGCTCCTCCTAA
 
. : . : . : . : . : . :
JMSF016M21- AACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTTCTGGCGGTTGT
JMSF017K07- AACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTTCTGGCGGTTGT
JMSF051A16- AACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTTCTGGCGGTTGT
rJMSF017K07+ AACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTTCTGGCGGTTGT
rJMSF015C08+ AACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTTCTGGCGGTTGT
rJMSF016M21+ AACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTTCTGGCGGTTGT
rJMSF051A16+ AACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTTCTGGCGGTTGT
                      ____________________________________________________________
consensus AACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTTCTGGCGGTTGT
 
. : . : . : . : . : . :
JMSF016M21- GATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCTATAGGTTATCT
JMSF017K07- GATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCTATAGGTTATCT
JMSF051A16- GATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCTATAGGTTATCT
rJMSF017K07+ GATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCTATAGGTTATCT
rJMSF015C08+ GATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCTATAGGTTATCT
rJMSF016M21+ GATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCTATAGGTTATCT
rJMSF051A16+ GATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCTATAGGTTATCT
                      ____________________________________________________________
consensus GATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCTATAGGTTATCT
 
. : . : . : . : . : . :
JMSF016M21- GTGCATTGTATTGAATATCATCATGTATGCTTCTCCC
JMSF017K07- GTGCATTGTATTGAATATCATCATGTATGCTTCTCCCTTGGCTGCAATGGGGACGGTATT
JMSF051A16- GTGCATTGTATTGAATATCATCATGTATGCTTCTCCCTTGGCTGCAATGGGGACGGTATT
rJMSF017K07+ GTGCATTGTATTGAATATCATCATGTATGCTTCTCCCTTGGCTGCAATGGGGACGGTATT
rJMSF015C08+ GTGCATTGTATTGAATATCATCATGTATGCTTCTCCCTTGGCTGCAATGGGGACGGTATT
rJMSF016M21+ GTGCATTGTATTGAATATCATCATGTATGCTTCTCCCTTGGCTGCAATGGGGACGGTATT
rJMSF051A16+ GTGCATTGTATTGAATATCATCATGTATGCTTCTCCCTTGGCTGCAATGGGGACGGTATT
                      ____________________________________________________________
consensus GTGCATTGTATTGAATATCATCATGTATGCTTCTCCCTTGGCTGCAATGGGGACGGTATT
 
. : . : . : . : . : . :
JMSF017K07- GAGGA
JMSF051A16- GAGGACCAAGAGTGTGGAGTTCATGCCCTTCTACCTCTCACTTTTCATCTGCTTAAACGG
rJMSF017K07+ GAGGACCAAGAGTGTGGAGTTCATGCCCTTCTACCTCTCACTTTTCATCTGCTTAAACGG
rJMSF015C08+ GAGGACCAAGAGTGTGGAGTTCATGCCCTTCTACCTCTCACTTTTCATCTGCTTAAACGG
rJMSF016M21+ GAGGACCAAGAGTGTGGAGTTCATGCCCTTCTACCTCTCACTTTTCATCTGCTTAAACGG
rJMSF051A16+ GAGGACCAAGAGTGTGGAGTTCATGCCCTTCTACCTCTCACTTTTCATCTGCTTAAACGG
                      ____________________________________________________________
consensus GAGGACCAAGAGTGTGGAGTTCATGCCCTTCTACCTCTCACTTTTCATCTGCTTAAACGG
 
. : . : . : . : . : . :
JMSF051A16- TGGCGTTTGGGCTGTGTATGCTTTCATAGTTCGTGACTGGTTTCTTGGGGTACCAAATGG
rJMSF017K07+ TGGCGTTTGGGCTGTGTATGCTTTCATAGTTCGTGACTGGTTTCTTGGGGTACCAAATGG
rJMSF015C08+ TGGCGTTTGGGCTGTGTATGCTTTCATAGTTCGTGACTGGTTTCTTGGGGTACCAAATGG
rJMSF016M21+ TGGCGTTTGGGCTGTGTATGCTTTCATAGTTCGTGACTGGTTTCTTGGGGTACCAAATGG
rJMSF051A16+ TGGCGTTTGGGCTGTGTATGCTTTCATAGTTCGTGACTGGTTTCTTGGGGTACCAAATGG
                      ____________________________________________________________
consensus TGGCGTTTGGGCTGTGTATGCTTTCATAGTTCGTGACTGGTTTCTTGGGGTACCAAATGG
 
. : . : . : . : . : . :
JMSF051A16- GACAGGATTCATATTTGGGGCAGTACAGCTAATATTGTATGCCATTTACAGCAAGCCAAA
rJMSF017K07+ GACAGGATTCATATTTGGGGCAGTACAGCTAATATTGTATGCCATTTACAGCAAGCCAAA
rJMSF015C08+ GACAGGATTCATATTTGGGGCAGTACAGCTAATATTGTATGCCATTTACAGCAAGCCAAA
rJMSF016M21+ GACAGGATTCATATTTGGGGCAGTACAGCTAATATTGTATGCCATTTACAGCAAGCCAAA
rJMSF051A16+ GACAGGATTCATATTTGGGGCAGTACAGCTAATATTGTATGCCATTTACAGCAAGCCAAA
                      ____________________________________________________________
consensus GACAGGATTCATATTTGGGGCAGTACAGCTAATATTGTATGCCATTTACAGCAAGCCAAA
 
. : . : . : . : . : . :
JMSF051A16- AACAGCA
rJMSF017K07+ AACAACAAAATCCTCCACTGCAGTATTAGAAGACAGTATGCAAAATGAGCCCTTGATTTC
rJMSF015C08+ AACAGCAAAATCCTCCACTGCAGTATTAGAAGACAGTATGCAAAATGAGCCCTTGATTTC
rJMSF016M21+ AACAGCAAAATCCTCCACTGCAGTATTAGAAGACAGTATGCAAAATGAGCCCTTGATTTC
rJMSF051A16+ AACAGCAAAATCCTCCACTGCAGTATTAGAAGACAGTATGCAAAATGAGCCCTTGATTTC
                      ____________________________________________________________
consensus AACAGCAAAATCCTCCACTGCAGTATTAGAAGACAGTATGCAAAATGAGCCCTTGATTTC
 
. : . : . : . : . : . :
rJMSF017K07+ AGCTTAGATTTGTCTTTATTTTATTTTATTTTTATTTTTATTTCCAGGTTTTTTATTATA
rJMSF015C08+ AGCTTAGATTTGTCTTTATTTTATTTTATTTTTATTTTTATTTCCAGGTTTTTTATTATA
rJMSF016M21+ AGCTTAGATTTGTCTTTATTTTATTTTATTTTTATTTTTATTTCCAGGTTTTTTATTATA
rJMSF051A16+ AGCTTAGATTTGTCTTTATTTTATTTTATTTTTATTTTTATTTCCAGGTTTTTTATTATA
                      ____________________________________________________________
consensus AGCTTAGATTTGTCTTTATTTTATTTTATTTTTATTTTTATTTCCAGGTTTTTTATTATA
 
. : . : . : . : . : . :
rJMSF017K07+ TATTTTCTCTTTATTTTTTGTTTTCTGTTTCTTAGCAACTTATTAAAAT
rJMSF015C08+ TATTTTCTCTTTATTTTTTGTTTTCTGTTTCTTAGCAACTTATTAAAATTTTATT
rJMSF016M21+ TATTTTCTCTTTATTTTTTGTTTTCTGTTTCTTAGCAACTTATTAAAATTTTATTGTATG
rJMSF051A16+ TATTTTCTCTTTATTTTTTGTTTTCTGTTTCTTAGCAACTTATTAAAATTTTATTGTATG
                      ____________________________________________________________
consensus TATTTTCTCTTTATTTTTTGTTTTCTGTTTCTTAGCAACTTATTAAAATTTTATTGTATG
 
. : . : . : . : . : . :
rJMSF016M21+ ATAAA
rJMSF051A16+ ATAAATGAAGATAATATGGATCATTATACAGCAATTTTTAGACTTCAGGTATTGCTGCTG
                      ____________________________________________________________
consensus ATAAATGAAGATAATATGGATCATTATACAGCAATTTTTAGACTTCAGGTATTGCTGCTG