Previous Contig 013915:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027O04Sequence394004634 (6)693013915 (4)gb:AF481952_18039375e-46Petunia x hybrida hairy meristem (HAM) mRNA, complete cds.
JMSF004L05Sequence426004634 (6)514013915 (4)gb:AF036303_17629393e-33Arabidopsis thaliana scarecrow-like 6 (SCL6) mRNA, partial cds.
JMSF016H16Sequence404004634 (6)768013915 (4)gb:AF036303_17629392e-51Arabidopsis thaliana scarecrow-like 6 (SCL6) mRNA, partial cds.
JMSF050P22Sequence708013915 (4)gb:AF036303_17629391e-39Arabidopsis thaliana scarecrow-like 6 (SCL6) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016H16+ TGAGCATCGATTCGTTGNACTCAACTTCGT
                      ____________________________________________________________
consensus TGAGCATCGATTCGTTGNACTCAACTTCGT
 
. : . : . : . : . : . :
rJMFF027O04+ CACTCCCACTTCATATCTCGGATAACGAAGCGATTGCTGTTAATCTCCCCGTTGGTT
rJMSF016H16+ GGTCACTCCCACTTCATATCTCGGATAACGAAGCGATTGCTGTTAATCTCCCCGTTGGTT
                      ____________________________________________________________
consensus GGTCACTCCCACTTCATATCTCGGATAACGAAGCGATTGCTGTTAATCTCCCCGTTGGTT
 
. : . : . : . : . : . :
rJMFF027O04+ GCTTCACCACCTACCAACTATCGCACCCTTTGGTGCTTCGTTTCGTTAAGCAGTTGATGC
rJMSF016H16+ GCTTCACCACCTACCAACTATCGCACCCTTTGGTGCTTCGTTTCGTTAAGCAGTTGATGC
                      ____________________________________________________________
consensus GCTTCACCACCTACCAACTATCGCACCCTTTGGTGCTTCGTTTCGTTAAGCAGTTGATGC
 
. : . : . : . : . : . :
rJMFF027O04+ CCAAGATTGTGGTTTCTGTAGACCGAGTTTGTGATCGGACCGACCTCCTATTCCCCCAAC
rJMSF016H16+ CCAAGATTGTGGTTTCTGTAGACCGAGTTTGTGATCGGACCGACCTCCTATT-CCCCAAC
rJMSF050P22+ GTTTCTGTAGACCGAGTTNGTGATCGGACCGACCTCCTATT-CCCCAAC
                      ____________________________________________________________
consensus CCAAGATTGTGGTTTCTGTAGACCGAGTTTGTGATCGGACCGACCTCCTATT-CCCCAAC
 
. : . : . : . : . : . :
rJMFF027O04+ CACGTAATCCACGCCCTTCAGTACTATGCCAACCTTCTCGAGTCTCTCGATGCTGTGAAT
rJMSF004L05+ TCTCGATGCTGTGAAT
rJMSF016H16+ CACGTAATCCACGCCCTTCAGTACTATGCCAACCTTCTCGAGTCTCTCGATGCTGTGAAT
rJMSF050P22+ CACGTAATCCACGCCCTTCAGTACTATGCCAACCTTCTCGAGTCTCTCGATGCTGTGAAT
                      ____________________________________________________________
consensus CACGTAATCCACGCCCTTCAGTACTATGCCAACCTTCTCGAGTCTCTCGATGCTGTGAAT
 
. : . : . : . : . : . :
rJMFF027O04+ GTGAACTTCGATGCCCTGCAGAAGATCGAGAGGTTCTTGCTCCATCCCGGGATCGAGAGA
rJMSF004L05+ GTGAACTTCGATGCCCTGCAGAAGATCGAGAGGTTCTTGCTCCATCCCGGGATCGAGAGA
rJMSF016H16+ GTGAACTTCGATGCCCTGCAGAAGATCGAGAGGTTCTTGCTCCATCCCGGGATCGAGAGA
rJMSF050P22+ GTGAACTTCGATGCCCTGCAGAAGATCGAGAGGTTCTTGCTCCATCCCGGGATCGAGAGA
                      ____________________________________________________________
consensus GTGAACTTCGATGCCCTGCAGAAGATCGAGAGGTTCTTGCTCCATCCCGGGATCGAGAGA
 
. : . : . : . : . : . :
rJMFF027O04+ ATCATAATGGGCCGTTATCGTTCCCCCGAGAAAACACAGCACTGGAGGACTCTGTTCCTA
rJMSF004L05+ ATCATAATGGGCCGTTATCGTTCCCCCGAGGAAACACAGCACTGGAGGACTCTGTTCCTA
rJMSF016H16+ ATCATAATGGGCCGTTATCGTTCCCCCGAGAAAACACAGCACTGGAGGACTCTGTTCCTA
rJMSF050P22+ ATCATAATGGGCCGTTATCGTTCCCCCGAGAAAACACAGCACTGGAGGACTCTGTTCCTA
                      ____________________________________________________________
consensus ATCATAATGGGCCGTTATCGTTCCCCCGAGAAAACACAGCACTGGAGGACTCTGTTCCTA
 
. : . : . : . : . : . :
rJMFF027O04+ TCGTCTGGATTCTCCCCATTGACTTTCAGCAATTTCACCGAGTCTCAAGCCGAGTGTGTG
rJMSF004L05+ TCGTCTGGATTCTCCCCATTGACTTTCAGCAATTTCACCGAGTCTCAAGCCGAGTGTGTG
rJMSF016H16+ TCGTCTGGATTCTCCCCATTGACTTTCAGCAATTTCACCGAGTCTCAAGCCGAGTGTGTG
rJMSF050P22+ TCGTCTGGATTCTCCCCATTGACTTTCAGCAATTTCACCGAGTCTCAAGCCGAGTGTGTG
                      ____________________________________________________________
consensus TCGTCTGGATTCTCCCCATTGACTTTCAGCAATTTCACCGAGTCTCAAGCCGAGTGTGTG
 
. : . : . : . : . : . :
rJMFF027O04+ GTGAAAAGAACTCCGGTCCGAGGGTTCCATGTCGAGAAGAGACAATCTTCTCTCGTTCTT
rJMSF004L05+ GTGAAAAGAACTCCGGTCCGAGGGTTCCATGTCGAGAAGAGACAATCTTCTCTCGTTCTT
rJMSF016H16+ GTGAAAAGAACTCCGGTCCGAGGGTTCCATGTCGAGAAGAGACAATCTTCTCTCGTTCTT
rJMSF050P22+ GTGAAAAGAACTCCGGTCCGAGGGTTCCATGTCGAGAAGAGACAATCTTCTCTCGTTCTT
                      ____________________________________________________________
consensus GTGAAAAGAACTCCGGTCCGAGGGTTCCATGTCGAGAAGAGACAATCTTCTCTCGTTCTT
 
. : . : . : . : . : . :
rJMFF027O04+ TGCTGGCAGCGGAAGGAGCTTATCTCGGTTTCAGCTTGGAGGTGCTGATCGAAGAAGAGC
rJMSF004L05+ TGCTGGCAGCGGAAGGAGCTTATCTCGGTTTCAGCTTGGAGGTGCTGATCGAAGAAGAGC
rJMSF016H16+ TGCTGGCAGCGGAAGGAGCTTATCTCGGTTTCAGCTTGGAGGTGCTGATCGAAGAAGAGC
rJMSF050P22+ TGCTGGCAGCGGAAGGAGCTTATCTCGGTTTCAGCTTGGAGGTGCTGATCGAAGAAGAGC
                      ____________________________________________________________
consensus TGCTGGCAGCGGAAGGAGCTTATCTCGGTTTCAGCTTGGAGGTGCTGATCGAAGAAGAGC
 
. : . : . : . : . : . :
rJMFF027O04+ AGACCCGTTCGATATTTAATCCCGTTCCTGATTATGAAGGTGTCATAATTCACTGTTTTA
rJMSF004L05+ AGACCCGTTCGATATTTAATCCCGTTCCTGATTATGAAGGTGTCATAATTCACTGTTTTA
rJMSF016H16+ AGACCCGTTCGATATTTAATCCCGTTCCTGATTATGAAGGTGTCATAATTCACTGTTTTA
rJMSF050P22+ AGACCCGTTCGATATTTAATCCCGTTCCTGATTATGAAGGTGTCATAATTCACTGTTTTA
                      ____________________________________________________________
consensus AGACCCGTTCGATATTTAATCCCGTTCCTGATTATGAAGGTGTCATAATTCACTGTTTTA
 
. : . : . : . : . : . :
rJMFF027O04+ GTATCTGAACATTTTCGATTTTCTTTTCTTGCCTATAGATTTTATTCGCTAATTGTCTTT
rJMSF004L05+ GTATCTGAACATTTTCGATTTTCTTTTCTTGCCTATAGATTTTATTCGCTAATTGTCTTT
rJMSF016H16+ GTATCTGAACATTTTCGATTTTCTTTTCTTGCCTATAGATTTTATTCGCTAATTGTCTTT
rJMSF050P22+ GTATCTGAACATTTTCGATTTTCTTTTCTTGCCTATAGATTTTATTCGCTAATTGTCTTT
                      ____________________________________________________________
consensus GTATCTGAACATTTTCGATTTTCTTTTCTTGCCTATAGATTTTATTCGCTAATTGTCTTT
 
. : . : . : . : . : . :
rJMFF027O04+ TGTGGCCTAGTCAGATTGTTTCAAAGTAAGGAAAAT
rJMSF004L05+ TGTGGCCTAGTCAGATTGTTTCAAAGTAAGGAAAATATCAAGACATTTTGGTAACTCGTT
rJMSF016H16+ TGTGGCCTAGTCAGATTGTTTCAAAGTAAGGAAAATATCAAGACATTTTGGTAACTCGTT
rJMSF050P22+ TGTGGCCTAGTCAGATTGTTTCAAAGTAAGGAAAATATCAAGACATTTTGGTAACTCGTT
                      ____________________________________________________________
consensus TGTGGCCTAGTCAGATTGTTTCAAAGTAAGGAAAATATCAAGACATTTTGGTAACTCGTT
 
. : . : . : . : . : . :
rJMSF004L05+ CTAGTATAGGGTT
rJMSF016H16+ CTAGTATAGGGTT
rJMSF050P22+ CTAGTATAGGGTTTATCTATTATTATTATGTTGAATGCGGTATTACTTTCATGATGCTCA
                      ____________________________________________________________
consensus CTAGTATAGGGTTTATCTATTATTATTATGTTGAATGCGGTATTACTTTCATGATGCTCA
 
. : . : . : . : . : . :
rJMSF050P22+ ATGATTTTCAGGAAGAAGGCATCAGTTTACGTTGGTTCTAATTGTGTTGGGAAATCTGTG
                      ____________________________________________________________
consensus ATGATTTTCAGGAAGAAGGCATCAGTTTACGTTGGTTCTAATTGTGTTGGGAAATCTGTG