Previous Contig 013907:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF031L12Sequence630006758 (2)gb:ATY16255_15575302e-05Arabidopsis thaliana ak-lys2 gene.743013907 (2)gb:AF135862_17710942e-99Glycine max precursor monofunctional aspartokinase mRNA, complete cds.
JMSF050N17Sequence668006758 (2)gb:AB007650_15102337e-22Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA22.764013907 (2)gb:AF135862_1771094e-100Glycine max precursor monofunctional aspartokinase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF031L12+ CGAGGCAGCTGAACTTGCTTATTT
rJMSF050N17+ TGTGCCATATTTACCNTNGACGAGGCAGCTGAACTTGCTTATTT
                      ____________________________________________________________
consensus TGTGCCATATTTACCNTNGACGAGGCAGCTGAACTTGCTTATTT
 
. : . : . : . : . : . :
rJMSF031L12+ TGGTGCACAGGTGCTCCATCCACAGTCAATGAGGCCTGCAAGAGAGGGTGGCATTCCTGT
rJMSF050N17+ TGGTGCACAGGTGCTCCATCCACAGTCAATGAGGCCTGCAAGAGAGGGTGGCATTCCTGT
                      ____________________________________________________________
consensus TGGTGCACAGGTGCTCCATCCACAGTCAATGAGGCCTGCAAGAGAGGGTGGCATTCCTGT
 
. : . : . : . : . : . :
rJMSF031L12+ TAGGGTCAAAAACTCATATAATCCAAAAGCTCCTGGTACCCTAATTACAAAAACAAGAGA
rJMSF050N17+ TAGGGTCAAAAACTCATATAATCCAAAAGCTCCTGGTACCCTAATTACAAAAACAAGAGA
                      ____________________________________________________________
consensus TAGGGTCAAAAACTCATATAATCCAAAAGCTCCTGGTACCCTAATTACAAAAACAAGAGA
 
. : . : . : . : . : . :
rJMSF031L12+ TATGAGTGAGGCAGTACTAACCAGCATTGTTTTGAAACGAAATGTCACGATGTTGGATAT
rJMSF050N17+ TATGAGTGAGGCAGTACTAACCAGCATTGTTTTGAAACGAAATGTCACGATGTTGGATAT
                      ____________________________________________________________
consensus TATGAGTGAGGCAGTACTAACCAGCATTGTTTTGAAACGAAATGTCACGATGTTGGATAT
 
. : . : . : . : . : . :
rJMSF031L12+ TGCCAGCACCCGCATGCTTGGTCAATATGGTTTCCTTGCAAAGGTTTTCTCTATCTTTGA
rJMSF050N17+ TGCCAGCACCCGCATGCTTGGTCAATATGGTTTCCTTGCAAAGGTTTTCTCTATCTTTGA
                      ____________________________________________________________
consensus TGCCAGCACCCGCATGCTTGGTCAATATGGTTTCCTTGCAAAGGTTTTCTCTATCTTTGA
 
. : . : . : . : . : . :
rJMSF031L12+ AGATTTAGGCATATCAGTTGATGTTGTTGCGACAAGTGAAGTTAGTATCTCTCTGACACT
rJMSF050N17+ AGATTTAGGCATATCAGTTGATGTTGTTGCGACAAGTGAAGTTAGTATCTCTCTGACACT
                      ____________________________________________________________
consensus AGATTTAGGCATATCAGTTGATGTTGTTGCGACAAGTGAAGTTAGTATCTCTCTGACACT
 
. : . : . : . : . : . :
rJMSF031L12+ GGACCCATCAAAACTCTGGAGCAGAGATCTGATTCAGCAGGCAAGCGAGCTTGATCACGT
rJMSF050N17+ GGACCCATCAAAACTCTGGAGCAGAGATCTGATTCAGCAGGCAAGCGAGCTTGATCACGT
                      ____________________________________________________________
consensus GGACCCATCAAAACTCTGGAGCAGAGATCTGATTCAGCAGGCAAGCGAGCTTGATCACGT
 
. : . : . : . : . : . :
rJMSF031L12+ TGTAGAAGAACTTGAGAAAATTGCAGTTGTGAATCTTCTTCAGCACAGATCAATTATCTC
rJMSF050N17+ TGTAGAAGAACTTGAGAAAATTGCAGTTGTGAATCTTCTTCAGCACAGATCAATTATCTC
                      ____________________________________________________________
consensus TGTAGAAGAACTTGAGAAAATTGCAGTTGTGAATCTTCTTCAGCACAGATCAATTATCTC
 
. : . : . : . : . : . :
rJMSF031L12+ TCTAATTGGGAATGTCCAGAGGTCCTCTCTAATTCTAGAAAAGGCTTTCCATGTTCTTCT
rJMSF050N17+ TCTAATTGGGAATGTCCAGAGGTCCTCTCTAATTCTAGAAAAGGCTTTCCATGTTCTTCT
                      ____________________________________________________________
consensus TCTAATTGGGAATGTCCAGAGGTCCTCTCTAATTCTAGAAAAGGCTTTCCATGTTCTTCT
 
. : . : . : . : . : . :
rJMSF031L12+ TACCAATGGGGTTAATGTTCAGATGATTTCCCAAGGAGCATCGAAGGTCAATATTTCATT
rJMSF050N17+ TACCAATGGGGTTAATGTTCAGATGATTTCCCAAGGAGCATCGAAGGTCAATATTTCATT
                      ____________________________________________________________
consensus TACCAATGGGGTTAATGTTCAGATGATTTCCCAAGGAGCATCGAAGGTCAATATTTCATT
 
. : . : . : . : . : . :
rJMSF031L12+ GATAGTGAACGACAGTGAAGCAGAGCAGTGCGTTGAAGCTCTTCACTCTGCCTTCTTTGA
rJMSF050N17+ GATAGTGAACGACAGTGAAGCAGAGCAGTGCGTTGAAGCTCTTCACTCTGCCTTCTTTGA
                      ____________________________________________________________
consensus GATAGTGAACGACAGTGAAGCAGAGCAGTGCGTTGAAGCTCTTCACTCTGCCTTCTTTGA
 
. : . : . : . : . : . :
rJMSF031L12+ GAGTGATCTCTCTAAACTAGTTTCGGATTAGAAATCTCAAAATGGTTCCTCTTCTGATTT
rJMSF050N17+ GAGTGATCTCTCTAAACTAGTTTCGGATTAGAAATCTCAAAATGGTTCCTCTTCTGATTT
                      ____________________________________________________________
consensus GAGTGATCTCTCTAAACTAGTTTCGGATTAGAAATCTCAAAATGGTTCCTCTTCTGATTT
 
. : . : . : . : . : . :
rJMSF031L12+ TCCAAATTAACTTGGATTATTGTTGTGTATACTCAAAGTGACATTCATAGTTGTGTATA
rJMSF050N17+ TCCAAATTAACTTGGATTATTGTTGTGTATACTCAAAGTGACATTCATAGTTGTGTATAC
                      ____________________________________________________________
consensus TCCAAATTAACTTGGATTATTGTTGTGTATACTCAAAGTGACATTCATAGTTGTGTATAC