Previous Contig 013906:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009F13Sequence453003884 (16)gb:AB124880_15280993e-27Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.745013906 (4)gb:AB124880_15280993e-96Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMFF028B19Sequence549003884 (16)gb:AB124880_15280993e-33Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.595013906 (4)gb:AB124880_15280993e-67Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.
JMSF034H06Sequence652003884 (16)gb:AB124880_15280993e-60Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.702013906 (4)gb:AB124879_1528098e-106Nicotiana tabacum mRNA for ubiquitin activating enzyme 1, complete cds.
JMSF050N12Sequence687003884 (16)gb:AB124880_15280991e-59Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.801013906 (4)gb:AB124880_1528099e-104Nicotiana tabacum mRNA for ubiquitin activating enzyme 2, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034H06+ CTGGAATTGTGCAGAGAGAAATTGCCT
rJMSF050N12+ ATTGTGCAGAGAGNAANTGCCT
                      ____________________________________________________________
consensus CTGGAATTGTGCAGAGAGAAATTGCCT
 
. : . : . : . : . : . :
rJMSF034H06+ GCAGGCTATAAGATGAACCCTATTCAGTTTGAGAAGGATGATGATACCAACTATCATATG
rJMFF009F13+ TTTGAGAAGGATGATGATACCAACTATCATATG
rJMSF050N12+ GCAGGCTATAAGATGAACCCTATTCAGTTTGAGAAGGATGATGATACCAACTATCATATG
                      ____________________________________________________________
consensus GCAGGCTATAAGATGAACCCTATTCAGTTTGAGAAGGATGATGATACCAACTATCATATG
 
. : . : . : . : . : . :
rJMSF034H06+ GACATGATTGCTGGACTTGCCAACATGAGAGCAAGAAATTACAGCATCCCTGAGGTTGAC
rJMFF009F13+ GACATGATTGCTGGACTTGCCAACATGAGAGCAAGAAATTACAGCATCCCTGAGGTTGAC
rJMSF050N12+ GACATGATTGCTGGACTTGCCAACATGAGAGCAAGAAATTACAGCATCCCTGAGGTTGAC
                      ____________________________________________________________
consensus GACATGATTGCTGGACTTGCCAACATGAGAGCAAGAAATTACAGCATCCCTGAGGTTGAC
 
. : . : . : . : . : . :
rJMSF034H06+ AAACTGAAAGCCAAATTCATTGCTGGGAGGATTATTCCCGCGATTGCTACTTCAACTGCT
rJMFF028B19+ TGCT
rJMFF009F13+ AAACTGAAAGCCAAATTCATTGCTGGGAGGATTATTCCCGCGATTGCTACTTCAACTGCT
rJMSF050N12+ AAACTGAAAGCCAAATTCATTGCTGGGAGGATTATTCCCGCGATTGCTACTTCAACTGCT
                      ____________________________________________________________
consensus AAACTGAAAGCCAAATTCATTGCTGGGAGGATTATTCCCGCGATTGCTACTTCAACTGCT
 
. : . : . : . : . : . :
rJMSF034H06+ ATGGCAACAGGTCTTGTTTGCTTAGAGCTATACAAGGCTCTGGATGGACAACACAAGGTG
rJMFF028B19+ ATGGCAACAGGTCTGGTTTGCTTAGAGCTATACAAGGCTCTGGATGGACAACACAAGGTG
rJMFF009F13+ ATGGCAACAGGTCTTGTTTGCTTAGAGCTATACAAGGCTCTGGATGGACAACACAAGGTG
rJMSF050N12+ ATGGCAACAGGTCTTGTTTGCTTAGAGCTATACAAGGCTCTGGATGGACAACACAAGGTG
                      ____________________________________________________________
consensus ATGGCAACAGGTCTTGTTTGCTTAGAGCTATACAAGGCTCTGGATGGACAACACAAGGTG
 
. : . : . : . : . : . :
rJMSF034H06+ GAGGATTACCGCAACACATTTGCAAATTTGGCACTCCCCTTGTTTTCAATCGCTGAGCCA
rJMFF028B19+ GAGGATTACCGCAACACATTTGCAAATTTGGCACTCCCCTTGTTTTCAATCGCTGAGCCA
rJMFF009F13+ GAGGATTACCGCAACACATTTGCAAATTTGGCACTCCCCTTGTTTTCAATCGCTGAGCCA
rJMSF050N12+ GAGGATTACCGCAACACATTTGCAAATTTGGCACTCCCCTTGTTTTCAATCGCTGAGCCA
                      ____________________________________________________________
consensus GAGGATTACCGCAACACATTTGCAAATTTGGCACTCCCCTTGTTTTCAATCGCTGAGCCA
 
. : . : . : . : . : . :
rJMSF034H06+ GTACCACCCAAAGTGATCAAACATCAAGACATGAGCTGGACTGTCTGGGACAGGTGGATT
rJMFF028B19+ GTACCACCCAAAGTGATCAAACATCAAGACATGAGCTGGACTGTCTGGGACAGGTGGATT
rJMFF009F13+ GTACCACCCAAAGTGATCAAACATCAAGACATGAGCTGGACTGTCTGGGACAGGTGGATT
rJMSF050N12+ GTACCACCCAAAGTGATCAAACATCAAGACATGAGCTGGACTGTCTGGGACAGGTGGATT
                      ____________________________________________________________
consensus GTACCACCCAAAGTGATCAAACATCAAGACATGAGCTGGACTGTCTGGGACAGGTGGATT
 
. : . : . : . : . : . :
rJMSF034H06+ TTGAGGGATAATCCGACACTGAAAGAGCTCATCAAGTGGCTCCAAGATAAAGGTCTAAAT
rJMFF028B19+ TTGAGGGATAATCCGACACTGAAAGAGCTCATCAAGTGGCTCCAAGATAAAGGTCTAAAT
rJMFF009F13+ TTGAGGGATAATCCGACACTGAAAGAGCTCATCAAGTGGCTCCAAGATAAAGGTCTAAAT
rJMSF050N12+ TTGAGGGATAATCCGACACTGAAAGAGCTCATCAAGTGGCTCCAAGATAAAGGTCTAAAT
                      ____________________________________________________________
consensus TTGAGGGATAATCCGACACTGAAAGAGCTCATCAAGTGGCTCCAAGATAAAGGTCTAAAT
 
. : . : . : . : . : . :
rJMSF034H06+ GCCTATAGCATCTCTTACGGCAGCTGCTTACTTTACAATAGCATGTTCCCTAGGCACAAG
rJMFF028B19+ GCCTATAGCATCTCTTACGGCAGCTGCTTACTTTACAATAGCATGTTCCCTAGGCACAAG
rJMFF009F13+ GCCTATAGCATCTCTTACGGCAGCTGCTTACTTTACAATAGCATGTTCCCTAGGCACAAG
rJMSF050N12+ GCCTATAGCATCTCTTACGGCAGCTGCTTACTTTACAATAGCATGTTCCCTAGGCACAAG
                      ____________________________________________________________
consensus GCCTATAGCATCTCTTACGGCAGCTGCTTACTTTACAATAGCATGTTCCCTAGGCACAAG
 
. : . : . : . : . : . :
rJMSF034H06+ GACCGCATAGATCGTAAGATGATGGATTTGGCCAGGGATGTTGCCAAGGCAGATTTCCCT
rJMFF028B19+ GACCGCATAGATCGTAAGATGATGGATTTGGCCAGGGATGTTGCCAAGGCAGATTTCCCT
rJMFF009F13+ GACCGCATAGATCGTAAGATGATGGATTTGGCCAGGGATGTTGCCAAGGCAGATTTCCCT
rJMSF050N12+ GACCGCATAGATCGTAAGATGATGGATTTGGCCAGGGATGTTGCCAAGGCAGATTTCCCT
                      ____________________________________________________________
consensus GACCGCATAGATCGTAAGATGATGGATTTGGCCAGGGATGTTGCCAAGGCAGATTTCCCT
 
. : . : . : . : . : . :
rJMSF034H06+ CCATATCGTCGTCATTTTGACATTGTGGTGGCTTGTGAGGACGATGATGATAATGATGTT
rJMFF028B19+ CCATATCGTCGTCATTTTGACATTGTGGTGGCTTGTGAGGACGATGATGATAATGATGTT
rJMFF009F13+ CCATATCGTCGTCATTTTGACATTGTGGTGGCTTGTGAGGACGATGATGATAATGATGTT
rJMSF050N12+ CCATATCGTCGTCATTTTGACATTGTGGTGGCTTGTGAGGACGATGATGATAATGATGTT
                      ____________________________________________________________
consensus CCATATCGTCGTCATTTTGACATTGTGGTGGCTTGTGAGGACGATGATGATAATGATGTT
 
. : . : . : . : . : . :
rJMSF034H06+ GATATACCTCAGATTTCTATATACTTCAGGTAGACCAGTTCGTTCCGACTTGTTGGAGGA
rJMFF028B19+ GATATACCTCAGATTTCTATATACTTCAGGTAGA-CAGTTCGTTCCGACTTGTTGGAGGA
rJMFF009F13+ GATATACCTCAGATTTCTATATACTTCAGGTAGA-CAGTTCGTTCCGACTTGTTGGAGGA
rJMSF050N12+ GATATACCTCAGATTTCTATATACTTCAGGTAGA-CAGTTCGTTCCGACTTGTTGGAGGA
                      ____________________________________________________________
consensus GATATACCTCAGATTTCTATATACTTCAGGTAGA-CAGTTCGTTCCGACTTGTTGGAGGA
 
. : . : . : . : . : . :
rJMSF034H06+ ATTGGGTAGAAATTG
rJMFF028B19+ ATTGGGTAGAAATTGTTTAGATTATTGATGTAATGTTTGATATTGCAATTTAGACTCCTG
rJMFF009F13+ ATTGGGTAGAAATTGTTTAGATTATTGATGTAATGTTTGATATTGCAATTTAGACTCCTG
rJMSF050N12+ ATTGGGTAGAAATTGTTTAGATTATTGATGTAATGTTTGATATTGCAATTTAGACTCCTG
                      ____________________________________________________________
consensus ATTGGGTAGAAATTGTTTAGATTATTGATGTAATGTTTGATATTGCAATTTAGACTCCTG
 
. : . : . : . : . : . :
rJMFF028B19+ TCTTTTTCGTCTAAGTATACATTTAGACATTCCGTGCATGCACGATCAAC
rJMFF009F13+ TCTTTTTCGTCTAAGTATACATTTAGACATTCCGTGCATGCACGATCAAC
rJMSF050N12+ TCTTTTTCGTCTAAGTATACATTTAGACATTCCGTGCATGCACGATCAACCAGTAGCTTT
                      ____________________________________________________________
consensus TCTTTTTCGTCTAAGTATACATTTAGACATTCCGTGCATGCACGATCAACCAGTAGCTTT