Previous Contig 013904:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007H24Sequence307005919 (5)gb:AC005309_15324725e-10Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>757013904 (4)gb:AC005309_15324727e-43Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>
JMSF007O18Sequence304005919 (5)gb:AC005309_15324725e-10Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>752013904 (4)gb:AC005309_15324722e-42Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>
JMSF008H24Sequence237005919 (5)gb:AC005309_15324723e-06Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>752013904 (4)gb:AC005309_15324722e-42Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>
JMSF050N03Sequence696005919 (5)pir|F84921|F849212e-30hypothetical protein At2g47960 [imported] - Arabidopsis thaliana752013904 (4)gb:AC005309_15324723e-29Arabidopsis thaliana chromosome 2 clone F17A22 map CIC06C03, complete sequence.>

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007O18+ TCA
rJMSF008H24+ TCA
rJMSF007H24+ TATCATCA
                      ____________________________________________________________
consensus TATCATCA
 
. : . : . : . : . : . :
rJMSF007O18+ GANGGATCTACACTGCTGAAAGTTGAGGGTAGTAATGTCCTAGGCAAACTTCAGATAACA
rJMSF008H24+ GAAGGATCTACNCTGCTGAAAGTTGAGGGTAGTAATGTCCTAGGCAAACTTCAGATAACA
rJMSF007H24+ GAAGGATCTACACTGCTGAAAGNTGAGGGTAGTAATGTCCTAGGCAAACTTCAGATAACA
                      ____________________________________________________________
consensus GAAGGATCTACACTGCTGAAAGTTGAGGGTAGTAATGTCCTAGGCAAACTTCAGATAACA
 
. : . : . : . : . : . :
rJMSF007O18+ TGGCGGACAAATTTGGGTGAACCGGGGCGTCTTCAGACGCAACAAATTCTTGGTAGTCCC
rJMSF008H24+ TGGCGGACAAATTTGGGTGAACCGGGGCGTCTTCAGACGCAACAAATTCTTGGTAGTCCC
rJMSF007H24+ TGGCGGACAAATTTGGGTGAACCGGGGCGTCTTCAGACGCAACAAATTCTTGGTAGTCCC
rJMSF050N03+ GTCTTCAGACGCAACAAATTCTTGGTAGTCCC
                      ____________________________________________________________
consensus TGGCGGACAAATTTGGGTGAACCGGGGCGTCTTCAGACGCAACAAATTCTTGGTAGTCCC
 
. : . : . : . : . : . :
rJMSF007O18+ ATTGTTCACAATGACATAGAGTTGGGGGCAGTGGAGGTACCGCCTATAATCATCATTGAG
rJMSF008H24+ ATTGTTCACAATGACATAGAGTTGGGGGCAGTGGAGGTACCGCCTATAATCATCATTGAG
rJMSF007H24+ ATTGTTCACAATGACATAGAGTTGGGGGCAGTGGAGGTACCGCCTATAATCATCATTGAG
rJMSF050N03+ ATTGTTCACAATGACATAGAGTTGGGGGCAGTGGAGGTACCGCCTATAATCATCATTGAG
                      ____________________________________________________________
consensus ATTGTTCACAATGACATAGAGTTGGGGGCAGTGGAGGTACCGCCTATAATCATCATTGAG
 
. : . : . : . : . : . :
rJMSF007O18+ AAGCCTTTTTTGGTACGCTTCAAGCTCACAAACCAGACTGACAGGATATTGGGTCCTTTT
rJMSF008H24+ AAGCCTTTTTTGGTACGCTTCAAGCTCACAAACCAGACTGACAGGATATTGGGTCCTTTT
rJMSF007H24+ AAGCCTTTTTTGGTACGCTTCAAGCTCACAAACCAGACTGACAGGATATTGGGTCCTTTT
rJMSF050N03+ AAGCCTTTTTTGGTACGCTTCAAGCTCACAAACCAGACTGACAGGATATTGGGTCCTTTT
                      ____________________________________________________________
consensus AAGCCTTTTTTGGTACGCTTCAAGCTCACAAACCAGACTGACAGGATATTGGGTCCTTTT
 
. : . : . : . : . : . :
rJMSF007O18+ GAAGTTTGGTTGTCACAAAGCGAATCACTAGATGAGAAATATGTGATGGTTAATGGTCCT
rJMSF008H24+ GAAGTTTGGTTGTCACAAAGCGAATCACTAGATGAGAAATATGTGATGGTTAATGGTCCT
rJMSF007H24+ GAAGTTTGGTTGTCACAAAGCGAATCACTAGATGAGAAATATGTGATGGTTAATGGTCCT
rJMSF050N03+ GAAGTTTGGTTGTCACAAAGCGAATCACTAGATGAGAAATATGTGATGGTTAATGGTCCT
                      ____________________________________________________________
consensus GAAGTTTGGTTGTCACAAAGCGAATCACTAGATGAGAAATATGTGATGGTTAATGGTCCT
 
. : . : . : . : . : . :
rJMSF007O18+ CAAACAATGCCTTTGCCACAGCTTGAAGCATTTGGCTCTTCAGAATTTCGTCTGAACTTG
rJMSF008H24+ CAAACAATGCCTTTGCCACAGCTTGAAGCATTTGGCTCTTCAGAATTTCGTCTGAACTTG
rJMSF007H24+ CAAACAATGCCTTTGCCACAGCTTGAAGCATTTGGCTCTTCAGAATTTCGTCTGAACTTG
rJMSF050N03+ CAAACAATGCCTTTGCCACAGCTTGAAGCATTTGGCTCTTCAGAATTTCGTCTGAACTTG
                      ____________________________________________________________
consensus CAAACAATGCCTTTGCCACAGCTTGAAGCATTTGGCTCTTCAGAATTTCGTCTGAACTTG
 
. : . : . : . : . : . :
rJMSF007O18+ GTTGCTGTAAAACAAGGCATACAGAAAATTGCAGGCATTACAATATTTGACATGCATGAG
rJMSF008H24+ GTTGCTGTAAAACAAGGCATACAGAAAATTGCAGGCATTACAATATTTGACATGCATGAG
rJMSF007H24+ GTTGCTGTAAAACAAGGCATACAGAAAATTGCAGGCATTACAATATTTGACATGCATGAG
rJMSF050N03+ GTTGCTGTAAAACAAGGCATACAGAAAATTGCAGGCATTACAATATTTGACATGCATGAG
                      ____________________________________________________________
consensus GTTGCTGTAAAACAAGGCATACAGAAAATTGCAGGCATTACAATATTTGACATGCATGAG
 
. : . : . : . : . : . :
rJMSF007O18+ AAGAAAACTTATGATTCTTTATTAGAATTGGAGATATTTGTCGATCCAGAGTAGTACTAA
rJMSF008H24+ AAGAAAACTTATGATTCTTTATTAGAATTGGAGATATTTGTCGATCCAGAGTAGTACTAA
rJMSF007H24+ AAGAAAACTTATGATTCTTTATTAGAATTGGAGATATTTGTCGATCCAGAGTAGTACTAA
rJMSF050N03+ AAGAAAACTTATGATTCTTTATTAGAATTGGAGATATTTGTCGATCCAGAGTAGTACTAA
                      ____________________________________________________________
consensus AAGAAAACTTATGATTCTTTATTAGAATTGGAGATATTTGTCGATCCAGAGTAGTACTAA
 
. : . : . : . : . : . :
rJMSF007O18+ GCAATTTTTGGCTGCGATGTCCTACAGAATCTTATTTCCTGCTTTGTTTGAAGAAGCCTT
rJMSF008H24+ GCAATTTTTGGCTGCGATGTCCTACAGAATCTTATTTCCTGCTTTGTTTGAAGAAGCCTT
rJMSF007H24+ GCAATTTTTGGCTGCGATGTCCTACAGAATCTTATTTCCTGCTTTGTTTGAAGAAGCCTT
rJMSF050N03+ GCAATTTTTGGCTGCGATGTCCTACAGAATCTTATTTCCTGCTTTGTTTGAAGAAGCCTT
                      ____________________________________________________________
consensus GCAATTTTTGGCTGCGATGTCCTACAGAATCTTATTTCCTGCTTTGTTTGAAGAAGCCTT
 
. : . : . : . : . : . :
rJMSF007O18+ TTCATAGTCCAAGAATACACGACCAGATAAGCCCAATTCACTCCCCATGAATAGGTTGGG
rJMSF008H24+ TTCATAGTCCAAGAATACACGACCAGATAAGCCCAATTCACTCCCCATGAATAGGTTGGG
rJMSF007H24+ TTCATAGTCCAAGAATACACGACCAGATAAGCCCAATTCACTCCCCATGAATAGGTTGGG
rJMSF050N03+ TTCATAGTCCAAGAATACACGACCAGATAAGCCCAATTCACTCCCCATGAATAGGTTGGG
                      ____________________________________________________________
consensus TTCATAGTCCAAGAATACACGACCAGATAAGCCCAATTCACTCCCCATGAATAGGTTGGG
 
. : . : . : . : . : . :
rJMSF007O18+ AAAATATAAGCAGGAGATTTTCATATCAAGATGCTGAGTTCAATCTTCTGGGATTGAGTT
rJMSF008H24+ AAAATATAAGCAGGAGATTTTCATATCAAGATGCTGAGTTCAATCTTCTGGGATTGAGTT
rJMSF007H24+ AAAATATAAGCAGGAGATTTTCATATCAAGATGCTGAGTTCAATCTTCTGGGATTGAGTT
rJMSF050N03+ AAAATATAAGCAGGAGATTTTCATATCAAGATGCTGAGTTCAATCTTCTGGGATTGAGTT
                      ____________________________________________________________
consensus AAAATATAAGCAGGAGATTTTCATATCAAGATGCTGAGTTCAATCTTCTGGGATTGAGTT
 
. : . : . : . : . : . :
rJMSF007O18+ GCAACTGTATACTACAGTATTTAGATGTTTGGATAAGTAATCAATATATTCTTAATCTTC
rJMSF008H24+ GCAACTGTATACTACAGTATTTAGATGTTTGGATAAGTAATCAATATATTCTTAATCTTC
rJMSF007H24+ GCAACTGTATACTACAGTATTTAGATGTTTGGATAAGTAATCAATATATTCTTAATCTTC
rJMSF050N03+ GCAACTGTATACTACAGTATTTAGATGTTTGGATAAGTAATCAATATATTCTTAATCTTC
                      ____________________________________________________________
consensus GCAACTGTATACTACAGTATTTAGATGTTTGGATAAGTAATCAATATATTCTTAATCTTC
 
. : . : . : . : . : . :
rJMSF007O18+ AGTTTTGGCATACCTTTCATTAGTCAAAT
rJMSF008H24+ AGTTTTGGCATACCTGTCATTAGNCAAAT
rJMSF007H24+ AGTTTTGGCATACCTTTCATTAGTCAAAT
rJMSF050N03+ AGTTTTGGCATACCTTTCATTAGTCAAATTGGATTGGTTGATGTCTTTAATTAGAGGGAT
                      ____________________________________________________________
consensus AGTTTTGGCATACCTTTCATTAGTCAAATTGGATTGGTTGATGTCTTTAATTAGAGGGAT
 
. : . : . : . : . : . :
rJMSF050N03+ AAAAGTGTTCCTTGCATAGTTGCATATATTCTCACTTTGATTTGACCAAGTAATAGTGTA
                      ____________________________________________________________
consensus AAAAGTGTTCCTTGCATAGTTGCATATATTCTCACTTTGATTTGACCAAGTAATAGTGTA