Previous Contig 013895:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003L20Sequence597000154 (2)pir|C84784|C847842e-47probable glucosyl transferase [imported] - Arabidopsis thaliana>gb:AC006282_1533717013895 (3)gb:AB070757_15227012e-44Vigna angularis AdGt-14 mRNA for glucosyltransferase-14, complete cds.
JMSF014B21Sequence742013895 (3)gb:AB070757_15227013e-48Vigna angularis AdGt-14 mRNA for glucosyltransferase-14, complete cds.
JMSF050J04Sequence687000154 (2)pir|C84784|C847841e-53probable glucosyl transferase [imported] - Arabidopsis thaliana>gb:AC006282_1533740013895 (3)gb:AB070757_15227014e-43Vigna angularis AdGt-14 mRNA for glucosyltransferase-14, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014B21+ AAGCCTCTCGCGATTGCCGACTCCTCAGATGATAGAGCT
                      ____________________________________________________________
consensus AAGCCTCTCGCGATTGCCGACTCCTCAGATGATAGAGCT
 
. : . : . : . : . : . :
rJMSF014B21+ CGGGCTCGCACTGGAGTCATCAAACCGCCCTTTCATTTGGGTTATCAGGCACATCTCCGA
rJMFF003L20+ TTTGGGTTATCAGGCACATCTCCGA
rJMSF050J04+ GTTATCAGGCACATCTCCGA
                      ____________________________________________________________
consensus CGGGCTCGCACTGGAGTCATCAAACCGCCCTTTCATTTGGGTTATCAGGCACATCTCCGA
 
. : . : . : . : . : . :
rJMSF014B21+ TGAGTTTCAAAACTGGCTTCGCCAAGAAAAATATGAGGAAAGAGTTAAAGAGCAACAAGG
rJMFF003L20+ TGAGTTTCAAAACTGGCTTCGCCAAGAAAAATATGAGGAAAGAGTTAAAGAGCAACAAGG
rJMSF050J04+ TGAGTTTCAAAACTGGCTTCGCCAAGAAAAATATGAGGAAAGAGTTAAAGAGCAACAAGG
                      ____________________________________________________________
consensus TGAGTTTCAAAACTGGCTTCGCCAAGAAAAATATGAGGAAAGAGTTAAAGAGCAACAAGG
 
. : . : . : . : . : . :
rJMSF014B21+ GCTTATCATNTATGGTTGGGCTCCGCAAGTGCTAATCTTGTCTCACCCGTCTATCGGAGG
rJMFF003L20+ GCTTATCATCTATGGTTGGGCTCCGCAAGTGCTAATCTTGTCTCACCCGTCTATCGGAGG
rJMSF050J04+ GCTTATCATCTATGGTTGGGCTCCGCAAGTGCTAATCTTGTCTCACCCGTCTATCGGAGG
                      ____________________________________________________________
consensus GCTTATCATCTATGGTTGGGCTCCGCAAGTGCTAATCTTGTCTCACCCGTCTATCGGAGG
 
. : . : . : . : . : . :
rJMSF014B21+ ATTCTTAACTCACTGCGGGTGGAACTCGTCCCTGGAAGCCATTACTTCCGGCTTGCCTTT
rJMFF003L20+ ATTCTTAACTCACTGCGGGTGGAACTCGTCCCTGGAAGCCATTACTTCCGGCTTGCCTTT
rJMSF050J04+ ATTCTTAACTCACTGCGGGTGGAACTCGTCCCTGGAAGCCATTACTTCCGGCTTGCCTTT
                      ____________________________________________________________
consensus ATTCTTAACTCACTGCGGGTGGAACTCGTCCCTGGAAGCCATTACTTCCGGCTTGCCTTT
 
. : . : . : . : . : . :
rJMSF014B21+ GATCACTTGGCCACTTTTTGGGGAGCAATTCTTGAACGAGAGGCTAATTGTGAATGTACT
rJMFF003L20+ GATCACTTGGCCACTTTTTGGGGAGCAATTCTTGAACGAGAGGCTAATTGTGAATGTACT
rJMSF050J04+ GATCACTTGGCCACTTTTTGGGGAGCAATTCTTGAACGAGAGGCTAATTGTGAATGTACT
                      ____________________________________________________________
consensus GATCACTTGGCCACTTTTTGGGGAGCAATTCTTGAACGAGAGGCTAATTGTGAATGTACT
 
. : . : . : . : . : . :
rJMSF014B21+ AAGAATCGGAGTGAAGACTGGAGTGGAGTTTCCTGTTTTGTTTGGAGCGGAAGAACAGAC
rJMFF003L20+ AAGAATCGGAGTGAAGACTGGAGTGGAGTTTCCTGTTTTGTTTGGAGCGGAAGAACAGAC
rJMSF050J04+ AAGAATCGGAGTGAAGACTGGAGTGGAGTTTCCTGTTTTGTTTGGAGCGGAAGAACAGAC
                      ____________________________________________________________
consensus AAGAATCGGAGTGAAGACTGGAGTGGAGTTTCCTGTTTTGTTTGGAGCGGAAGAACAGAC
 
. : . : . : . : . : . :
rJMSF014B21+ AGGAGTCCAAGTGAATAGAGATGATATTGTAGTGGCCANTGAGGAAGTGATGGGTGGAGG
rJMFF003L20+ AGGAGTCCAAGTGAATAGAGATGATATTGTAGTGGCCATTGAGGAAGTGATGGGTGGAGG
rJMSF050J04+ AGGAGTCCAAGTGAATAGAGATGATATTGTAGTGGCCATTGAGGAAGTGATGGGTGGAGG
                      ____________________________________________________________
consensus AGGAGTCCAAGTGAATAGAGATGATATTGTAGTGGCCATTGAGGAAGTGATGGGTGGAGG
 
. : . : . : . : . : . :
rJMSF014B21+ AGAGGAGGCTGAAATGAGAAGAAAAAGAATGAAAAAGCTTGGAGAAANGGCAAGGNCGGC
rJMFF003L20+ AGAGGAGGCTGAAATGAGAAGAAAAAGAATGAAAAAGCTTGGAGAAATGGCAAGGACGGC
rJMSF050J04+ AGAGGAGGCTGAAATGAGAAGAAAAAGAATGAAAAAGCTTGGAGAAATGGCAAGGACGGC
                      ____________________________________________________________
consensus AGAGGAGGCTGAAATGAGAAGAAAAAGAATGAAAAAGCTTGGAGAAATGGCAAGGACGGC
 
. : . : . : . : . : . :
rJMSF014B21+ AATGGAGGGAGGAGGTTCATCTTTCCATAATATTGCCAAACTANTTCAGGATGTTGCAGA
rJMFF003L20+ AATGGAGGGAGGAGGTTCATCTTTCCATAATATTGCCAAACTAATTCAGGATGTTGCAGA
rJMSF050J04+ AATGGAGGGAGGAGGTTCATCTTTCCATAATATTGCCAAACTAATTCAGGATGTTGCAGA
                      ____________________________________________________________
consensus AATGGAGGGAGGAGGTTCATCTTTCCATAATATTGCCAAACTAATTCAGGATGTTGCAGA
 
. : . : . : . : . : . :
rJMSF014B21+ GGAATC
rJMFF003L20+ GGAATCGAACGCTAGGACATCAGTTTAAGACTATCATGTTAAGGCATAAGCACCTGTTAG
rJMSF050J04+ GGAATCGAACGCTAGGACATCAGTTTAAGACTATCATGTTAAGGCATAAGCACCTGTTAG
                      ____________________________________________________________
consensus GGAATCGAACGCTAGGACATCAGTTTAAGACTATCATGTTAAGGCATAAGCACCTGTTAG
 
. : . : . : . : . : . :
rJMFF003L20+ AGTTTTATGCAATCTTTCCTTAGCTATGGCAGGTTATTATTGTAGCTTTCCTTGTAATGC
rJMSF050J04+ AGTTTTATGCAATCTTTCCTTAGCTATGGCAGGTTATTATTGTAGCTTTCCTTGTAATGC
                      ____________________________________________________________
consensus AGTTTTATGCAATCTTTCCTTAGCTATGGCAGGTTATTATTGTAGCTTTCCTTGTAATGC
 
. : . : . : . : . : . :
rJMFF003L20+ TCCGTTATCTTTGGTTCTGCAGTTGTACATTTGTATAGATATATTGCTCCTAGATTTTCA
rJMSF050J04+ TCCGTTATCTTTGGTTCTGCAGTTGTACATTTGTATAGATATATTGCTCCTAGATTTTCA
                      ____________________________________________________________
consensus TCCGTTATCTTTGGTTCTGCAGTTGTACATTTGTATAGATATATTGCTCCTAGATTTTCA
 
. : . : . : . : . : . :
rJMFF003L20+ ATAAAATGTATCTCTCTTCTCTGTTTATACAC
rJMSF050J04+ ATAAAATGTATCTCTCTTCTCTGTTTATACACTGCATATCTTACATGGTATCAAGAGTTT
                      ____________________________________________________________
consensus ATAAAATGTATCTCTCTTCTCTGTTTATACACTGCATATCTTACATGGTATCAAGAGTTT