Previous Contig 013889:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007K20Sequence350008001 (7)sp|Q9SVN5|SYM_ARATH4e-16Probable methionyl-tRNA synthetase (EC 6.1.1.10) (Methionine--tRNA ligase) (MetR743013889 (5)sp|Q9SVN5|SYM_ARATH2e-61Probable methionyl-tRNA synthetase (EC 6.1.1.10) (Methionine--tRNA ligase) (MetR
JMSF026B18Sequence638008001 (7)sp|Q9SVN5|SYM_ARATH3e-75Probable methionyl-tRNA synthetase (EC 6.1.1.10) (Methionine--tRNA ligase) (MetR709013889 (5)gb:AP003618_18315244e-68Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P056
JMSF045N21Sequence741008001 (7)sp|Q9SVN5|SYM_ARATH9e-89Probable methionyl-tRNA synthetase (EC 6.1.1.10) (Methionine--tRNA ligase) (MetR711013889 (5)gb:AP003618_18315244e-68Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P056
JMSF048I16Sequence682008001 (7)sp|Q9SVN5|SYM_ARATH2e-83Probable methionyl-tRNA synthetase (EC 6.1.1.10) (Methionine--tRNA ligase) (MetR799013889 (5)gb:AP003618_18315249e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P056
JMSF050H23Sequence677008001 (7)sp|Q9SVN5|SYM_ARATH3e-74Probable methionyl-tRNA synthetase (EC 6.1.1.10) (Methionine--tRNA ligase) (MetR728013889 (5)gb:AP003618_18315242e-68Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P056

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007K20+ ATCTCATTCCTCAACTAAGGCTTTAGCAGAGA
                      ____________________________________________________________
consensus ATCTCATTCCTCAACTAAGGCTTTAGCAGAGA
 
. : . : . : . : . : . :
rJMSF007K20+ AGGTCGGAAACTATTTGGATCAATATATTGAAGCCATGGAAAAGGTAAAATTGAAGCAAG
                      ____________________________________________________________
consensus AGGTCGGAAACTATTTGGATCAATATATTGAAGCCATGGAAAAGGTAAAATTGAAGCAAG
 
. : . : . : . : . : . :
rJMSF007K20+ CCTTGAAGATTGCCATGTCTCTTTCTGGTGAAGGAAATGCTTATTTGCAAGAGAGCCAAT
                      ____________________________________________________________
consensus CCTTGAAGATTGCCATGTCTCTTTCTGGTGAAGGAAATGCTTATTTGCAAGAGAGCCAAT
 
. : . : . : . : . : . :
rJMSF007K20+ TTTGGAAGCTTTACAAGGAAGATAAACCTTCATGTTCCGTAGTTATGAGAACTGCTGCTG
                      ____________________________________________________________
consensus TTTGGAAGCTTTACAAGGAAGATAAACCTTCATGTTCCGTAGTTATGAGAACTGCTGCTG
 
. : . : . : . : . : . :
rJMSF007K20+ GTCTAGTTTATCTACTCGCTTTCCTTTTAGAGCCTTTTATGCCTTCTTTTTCACGTGAGG
                      ____________________________________________________________
consensus GTCTAGTTTATCTACTCGCTTTCCTTTTAGAGCCTTTTATGCCTTCTTTTTCACGTGAGG
 
. : . : . : . : . : . :
rJMSF007K20+ TATTCAAGCAGTTAAACTTGCCTGAATCATGGCTTTCACTTTNTGATGAAAATGGTGACN
                      ____________________________________________________________
consensus TATTCAAGCAGTTAAACTTGCCTGAATCATGGCTTTCACTTTNTGATGAAAATGGTGACN
 
. : . : . : . : . : . :
rJMSF007K20+ TTGAAAGGGCTAAAAAGCCCTGGGATATTTTACCTGCTGGTCACAAAATTGGAACACCTG
                      ____________________________________________________________
consensus TTGAAAGGGCTAAAAAGCCCTGGGATATTTTACCTGCTGGTCACAAAATTGGAACACCTG
 
. : . : . : . : . : . :
rJMSF007K20+ TGCCATTATTCAAGGAATTGAAAGATGAAGAAGTTGAAATGTACCGGGAGAAGTTTGCTG
rJMSF048I16+ TGTACCGGGAGAAGTTTGCTG
                      ____________________________________________________________
consensus TGCCATTATTCAAGGAATTGAAAGATGAAGAAGTTGAAATGTACCGGGAGAAGTTTGCTG
 
. : . : . : . : . : . :
rJMSF007K20+ GAAGTCAAGCTGACAGGACCTTGAGGGTAGAAGCTGAAGCAAAGAAGATTACTGAACAAT
rJMSF048I16+ GAAGTCAAGCTGATAGGACCTTGAGGGTAGAAGCTGAAGCAAAGAAGATTACTGAACAAT
                      ____________________________________________________________
consensus GAAGTCAAGCTGATAGGACCTTGAGGGTAGAAGCTGAAGCAAAGAAGATTACTGAACAAT
 
. : . : . : . : . : . :
rJMSF007K20+ TGAATAAAGCAAAAATTTCAAGTGAAAAAATA---AAGGAGCGATCAACAAAATCAGCTC
rJMSF048I16+ TGAATAAAGCAAAAATTTCAAATGAAAAAACAAAGAAGGAACGATCAACAAAATCAGCTC
rJMSF026B18+ AAGGAACGATCAACAAAATCAGCTC
rJMSF045N21+ ATCAGCTC
rJMSF050H23+ ATCAGCTC
                      ____________________________________________________________
consensus TGAATAAAGCAAAAATTTCAAGTGAAAAAATAAAGAAGGAACGATCAACAAAATCAGCTC
 
. : . : . : . : . : . :
rJMSF007K20+ AAGCCAAGTCGAAGGCTGGAGCATCTGTCT
rJMSF048I16+ AAGCCAAGTCGAAGGCTGGAGCATCTGTCTCTGCTGAAGCTGAAGTATCCATTAGCCGAC
rJMSF026B18+ AAGCCAAGTCGAAGGCTGGAGCATCTGTCTCTGCTGAAGCTGAAGTATCCATTAGCCGAC
rJMSF045N21+ AAGCCAAGTCGAAGGCTGGAGCATCTGTCTCTGCTGAAGCTGAAGTATCCATTAGCCGAC
rJMSF050H23+ AAGCCCAGTCGAAGGCTGGAGCATCTGTCTCTGCTGAAGCTGAAGTATCCATTAGCCGAC
                      ____________________________________________________________
consensus AAGCCAAGTCGAAGGCTGGAGCATCTGTCTCTGCTGAAGCTGAAGTATCCATTAGCCGAC
 
. : . : . : . : . : . :
rJMSF048I16+ TTGATATCCGTGTTGGTCTTATCAAGAAAGCCCAAAAGCATCCTGATGCTGATTCTCTGT
rJMSF026B18+ TTGATATCCGTGTTGGTCTTATCAAGAAAGCCCAAAAGCATCCTGATGCTGATTCTCTGT
rJMSF045N21+ TTGATATCCGTGTTGGTCTTATCAAGAAAGCCCAAAAGCATCCTGATGCTGATTCTCTGT
rJMSF050H23+ TTGATATCCGTGTTGGTCTTATCAAGAAAGCCCAAAAGCATCCTGATGCTGATTCTCTGT
                      ____________________________________________________________
consensus TTGATATCCGTGTTGGTCTTATCAAGAAAGCCCAAAAGCATCCTGATGCTGATTCTCTGT
 
. : . : . : . : . : . :
rJMSF048I16+ ATGTAGAAGAGATTGATGTTGGTGAAGCACAACCTAGGACTGTTGTTAGTGGCCTAGTCA
rJMSF026B18+ ATGTAGAAGAGATTGATGTTGGTGAAGCACAACCTAGGACTGTTGTTAGTGGCCTAGTCA
rJMSF045N21+ ATGTAGAAGAGATTGATGTTGGTGAAGCACAACCTAGGACTGTTGTTAGTGGCCTAGTCA
rJMSF050H23+ ATGTAGAAGAGATTGATGTTGGTGAAGCACAACCTAGGACTGTTGTTAGTGGCCTAGTCA
                      ____________________________________________________________
consensus ATGTAGAAGAGATTGATGTTGGTGAAGCACAACCTAGGACTGTTGTTAGTGGCCTAGTCA
 
. : . : . : . : . : . :
rJMSF048I16+ AGTATATTCCACTTGAAGAGATGCAGAATCGTAAGGTCTGTGTTCTTTGCAACCTGAAGC
rJMSF026B18+ AGTATATTCCACTTGAAGAGATGCAGAATCGTAAGGTCTGTGTTCTTTGCAACCTGAAGC
rJMSF045N21+ AGTATATTCCACTTGAAGAGATGCAGAATCGTAAGGTCTGTGTTCTTTGCAACCTGAAGC
rJMSF050H23+ AGTATATTCCACTTGAAGAGATGCAGAATCGTAAGGTCTGTGTTCTTTGCAACCTGAAGC
                      ____________________________________________________________
consensus AGTATATTCCACTTGAAGAGATGCAGAATCGTAAGGTCTGTGTTCTTTGCAACCTGAAGC
 
. : . : . : . : . : . :
rJMSF048I16+ CAGCAACCATGAGGGGTATTAAATCTCAAGCGATGGTTCTTGCTGCTTCTAACAATGATC
rJMSF026B18+ CAGCAACCATGAGGGGTATTAAATCTCAAGCGATGGTTCTTGCTGCTTCTAACAATGATC
rJMSF045N21+ CAGCAACCATGAGGGGTATTAAATCTCAAGCGATGGTTCTTGCTGCTTCTAACAATGATC
rJMSF050H23+ CAGCAACCATGAGGGGTATTAAATCTCAAGCGATGGTTCTTGCTGCTTCTAACAATGATC
                      ____________________________________________________________
consensus CAGCAACCATGAGGGGTATTAAATCTCAAGCGATGGTTCTTGCTGCTTCTAACAATGATC
 
. : . : . : . : . : . :
rJMSF048I16+ ATACTAAGGTTGAATTGGTGGAGCCACCTCAAGATGCTGGTGTTGGTGAGCGTGTAACAT
rJMSF026B18+ ATACTAAGGTTGAATTGGTGGAGCCACCTCAAGATGCTGGTGTTGGTGAGCGTGTAACAT
rJMSF045N21+ ATACTAAGGTTGAATTGGTGGAGCCACCTCAAGATGCTGGTGTTGGTGAGCGTGTAACAT
rJMSF050H23+ ATACTAAGGTTGAATTGGTGGAGCCACCTCAAGATGCTGGTGTTGGTGAGCGTGTAACAT
                      ____________________________________________________________
consensus ATACTAAGGTTGAATTGGTGGAGCCACCTCAAGATGCTGGTGTTGGTGAGCGTGTAACAT
 
. : . : . : . : . : . :
rJMSF048I16+ TTTTGGGATTTGAAGGCAAGGCTGACGATGTGTTGAACCCCAAGAAGAAGGTTTGGGAAA
rJMSF026B18+ TTTTGGGATTTGAAGGCAAGGCTGACGATGTGTTGAACCCCAAGAAGAAGGTTTGGGAAA
rJMSF045N21+ TTTTGGGATTTGAAGGCAAGGCCGACGATGTGTTGAACCCCAAGAAGAAGGTTTGGGAAA
rJMSF050H23+ TTTTGGGATTTGAAGGCAAGGCTGACGATGTGTTGAACCCCAAGAAGAAGGTTTGGGAAA
                      ____________________________________________________________
consensus TTTTGGGATTTGAAGGCAAGGCTGACGATGTGTTGAACCCCAAGAAGAAGGTTTGGGAAA
 
. : . : . : . : . : . :
rJMSF048I16+ CCCTACAAGTGGATTTTCACACTAACAAGGAGTTAGTAGCTTGCTACAAGGATATTCCAT
rJMSF026B18+ CCCTACAAGTGGATTTTCACACTAACAAGGAGTTAGTAGCTTGCTACAAGGATATTCCAT
rJMSF045N21+ CCCTACAAGTGGATTTTCACACTAACAAGGAGTTAGTAGCTTGCTACAAGGATATTCCAT
rJMSF050H23+ CCCTACAAGTGGATTTTCACACTAACAAGGAGTTAGTAGCTTGCTACAAGGATATTCCAT
                      ____________________________________________________________
consensus CCCTACAAGTGGATTTTCACACTAACAAGGAGTTAGTAGCTTGCTACAAGGATATTCCAT
 
. : . : . : . : . : . :
rJMSF048I16+ TCACCACATCAGCTGGGGTGTGCAAGGTTTCATCCATCTCCGAAGGATCTATAAGATAGA
rJMSF026B18+ TCACCACATCAGCTGGGGTGTGCAAGGTTTCATCCATCTCCGAAGGATCTATAAGATAGA
rJMSF045N21+ TCACCACATCAGCTGGGGTGTGCAAGGTTTCATCCATCTCCGAAGGATCTATAAGATAGA
rJMSF050H23+ TCACCACATCAGCTGGGGTGTGCAAGGTTTCATCCATCTCCGAAGGATCTATAAGATAGA
                      ____________________________________________________________
consensus TCACCACATCAGCTGGGGTGTGCAAGGTTTCATCCATCTCCGAAGGATCTATAAGATAGA
 
. : . : . : . : . : . :
rJMSF048I16+ CGTAGACTTGCATTTTGAAAAGAAAATTCTCTACAGTTTTGTGTATTTCCTATTCTGGTT
rJMSF026B18+ CGTAGACTTGCATTTTGAAAAGAAAATTCTCTACAGTTTTGTGTATTTCCTATTCTGGTT
rJMSF045N21+ CGTAGACTTGCATTTTGAAAAGAAAATTCTCTACAGTTTTGTGTATTTCCTATTCTGGTT
rJMSF050H23+ CGTAGACTTGCATTTTGAAAAGAAAATTCTCTACAGTTTTGTGTATTTCCTATTCTGGTT
                      ____________________________________________________________
consensus CGTAGACTTGCATTTTGAAAAGAAAATTCTCTACAGTTTTGTGTATTTCCTATTCTGGTT
 
. : . : . : . : . : . :
rJMSF048I16+ TAGTTGTTTTTTCAAAATATCATTAATGATTGTTTAATGGCGATTGTCAATTGCTGCT
rJMSF026B18+ TAGTTGTTTTTTCAAAATATCATTAATGATTGTTTAATGGCGATTGTCAATTGCTGCT
rJMSF045N21+ TAGTTGTTTTTTCAAAATATCATTAATGATTGTTTAATGGCGATTGTCAATTGCTGCTGT
rJMSF050H23+ TAGTTGTTTTTTCAAAATATCATTAATGATTGTTTAATGGCGATTGTCAATTGCTGCTGT
                      ____________________________________________________________
consensus TAGTTGTTTTTTCAAAATATCATTAATGATTGTTTAATGGCGATTGTCAATTGCTGCTGT
 
. : . : . : . : . : . :
rJMSF045N21+ TCTAA-CCTTATGTTTGCACTCTATAAGGATGTTAC
rJMSF050H23+ TCTAACCCTTATGTTTGCACTCTATAAGGATGTTACCAAAGATGTACTTCCAGAATGCTG
                      ____________________________________________________________
consensus TCTAACCCTTATGTTTGCACTCTATAAGGATGTTACCAAAGATGTACTTCCAGAATGCTG