Previous Contig 013884:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF050F21Sequence697013884 (2)gb:AY087265_15722996e-67Arabidopsis thaliana clone 33407 mRNA, complete sequence.640013884 (2)gb:AY087265_15722997e-69Arabidopsis thaliana clone 33407 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF050F21- GG
                      ____________________________________________________________
consensus GG
 
. : . : . : . : . : . :
JMSF050F21- AAAATGGAAACAGCTCTCAGCTTCAGGAGCTCCACTTGGGTCCCAGTCACGACGTCGTTT
                      ____________________________________________________________
consensus AAAATGGAAACAGCTCTCAGCTTCAGGAGCTCCACTTGGGTCCCAGTCACGACGTCGTTT
 
. : . : . : . : . : . :
JMSF050F21- CCTCAGTCTCATGTCAAGCTCAATTTATTGAGATTAAAGCGCTCCAGACGAGTGCAGAAT
                      ____________________________________________________________
consensus CCTCAGTCTCATGTCAAGCTCAATTTATTGAGATTAAAGCGCTCCAGACGAGTGCAGAAT
 
. : . : . : . : . : . :
JMSF050F21- CGGCAGAATAATTGCCTGTTGATAGTGAAGTCTTCCGGGTCGAGCATCAATGGGTCTTCT
                      ____________________________________________________________
consensus CGGCAGAATAATTGCCTGTTGATAGTGAAGTCTTCCGGGTCGAGCATCAATGGGTCTTCT
 
. : . : . : . : . : . :
JMSF050F21- GACCCGTCTCCAGTCTCACCGAACAATATTTTCGTGGAAGAGGCCATTGGAGCAGAATAT
                      ____________________________________________________________
consensus GACCCGTCTCCAGTCTCACCGAACAATATTTTCGTGGAAGAGGCCATTGGAGCAGAATAT
 
. : . : . : . : . : . :
JMSF050F21- GGAGAGGGGTTTGAGACATTTAGAGCGGATGGATTACTCAAAGTTGATGTTGATTTTCTA
                      ____________________________________________________________
consensus GGAGAGGGGTTTGAGACATTTAGAGCGGATGGATTACTCAAAGTTGATGTTGATTTTCTA
 
. : . : . : . : . : . :
JMSF050F21- AATGATAGACTGCAAGAAGGTTTCCTTCAAAGAATCCGGTATGCAATGAAACCTGACGAA
                      ____________________________________________________________
consensus AATGATAGACTGCAAGAAGGTTTCCTTCAAAGAATCCGGTATGCAATGAAACCTGACGAA
 
. : . : . : . : . : . :
JMSF050F21- GCTTATGGATTAGTTTTCTCTTGGGACAATGTAGTGGCAGATACTCATGCTCTAAGGTTG
                      ____________________________________________________________
consensus GCTTATGGATTAGTTTTCTCTTGGGACAATGTAGTGGCAGATACTCATGCTCTAAGGTTG
 
. : . : . : . : . : . :
JMSF050F21- AATGCCTGGAAGCAACTTGCTTCTGAAGAAGGGAAGGAAATTGCCGAAGATGATAGTATG
                      ____________________________________________________________
consensus AATGCCTGGAAGCAACTTGCTTCTGAAGAAGGGAAGGAAATTGCCGAAGATGATAGTATG
 
. : . : . : . : . : . :
JMSF050F21- CAAAGACTTTTGCTTTATGGTGGTGTCGATCATGTACTAAACAAGGTGTTGCGGTGGGAG
                      ____________________________________________________________
consensus CAAAGACTTTTGCTTTATGGTGGTGTCGATCATGTACTAAACAAGGTGTTGCGGTGGGAG
 
. : . : . : . : . : . :
JMSF050F21- AAGGAAGAAAATGATTTGGTTCGATTGAGGTTAAGGTTATCACAGTTATTCTGTGACAAT
                      ____________________________________________________________
consensus AAGGAAGAAAATGATTTGGTTCGATTGAGGTTAAGGTTATCACAGTTATTCTGTGACAAT
 
. : . : . : . : . : . :
JMSF050F21- CTACTCCAACTCTCGAAACCAATCGAAGGGCTGAAGGAATGGCTTGATGCTATATCAACA
rJMSF050F21+ AATCGAAGGGCTGAAGGAATGGCTTGATGCTATATCAACA
                      ____________________________________________________________
consensus CTACTCCAACTCTCGAAACCAATCGAAGGGCTGAAGGAATGGCTTGATGCTATATCAACA
 
. : . : . : . : . : . :
JMSF050F21- GCACGCATTCCTTGTGCAGTTGTTTCAAATCTAGA
rJMSF050F21+ GCACGCATTCCTTGTGCAGTTGTTTCAAATCTAGATCGAAAAAATATGGTTGACGCCTTA
                      ____________________________________________________________
consensus GCACGCATTCCTTGTGCAGTTGTTTCAAATCTAGATCGAAAAAATATGGTTGACGCCTTA
 
. : . : . : . : . : . :
rJMSF050F21+ GAACACCTGGGGCTCATGAAGTATTTTCAGGCTATTGTGTCAGAGGAAGACGGCATGGAA
                      ____________________________________________________________
consensus GAACACCTGGGGCTCATGAAGTATTTTCAGGCTATTGTGTCAGAGGAAGACGGCATGGAA
 
. : . : . : . : . : . :
rJMSF050F21+ TCCATAGCACAGAGGTTTCTTTCTGCAGCGGTAAAGTTGGATAGGAAGCCATCTAAGTGC
                      ____________________________________________________________
consensus TCCATAGCACAGAGGTTTCTTTCTGCAGCGGTAAAGTTGGATAGGAAGCCATCTAAGTGC
 
. : . : . : . : . : . :
rJMSF050F21+ GTGGTGTTTGAAGACGACCCTAGAGGCATAACAGCGGCTCACAACTGTACAATGATGGCT
                      ____________________________________________________________
consensus GTGGTGTTTGAAGACGACCCTAGAGGCATAACAGCGGCTCACAACTGTACAATGATGGCT
 
. : . : . : . : . : . :
rJMSF050F21+ GTAGCACTCATCGGTGCTCACCCAGCGTATCATTTGGATCAGGCTGACCTTACAGTTGGC
                      ____________________________________________________________
consensus GTAGCACTCATCGGTGCTCACCCAGCGTATCATTTGGATCAGGCTGACCTTACAGTTGGC
 
. : . : . : . : . : . :
rJMSF050F21+ GGCTACAATGAGCTTTCAGTCATCAATCTCAGGAGATTATTTGCGCATAAAGGCTCCAAC
                      ____________________________________________________________
consensus GGCTACAATGAGCTTTCAGTCATCAATCTCAGGAGATTATTTGCGCATAAAGGCTCCAAC
 
. : . : . : . : . : . :
rJMSF050F21+ TTTATGGACCTGGAGAAGCAAATTGTGGAGAGAACTCCCCCCAGAAGGAAGCTGAGAATT
                      ____________________________________________________________
consensus TTTATGGACCTGGAGAAGCAAATTGTGGAGAGAACTCCCCCCAGAAGGAAGCTGAGAATT
 
. : . : . : . : . : . :
rJMSF050F21+ GACACCATTTTNTGATCCAAATCCAACCCTCTTTCACCTCACTTGTACATTTTTCATTAG
                      ____________________________________________________________
consensus GACACCATTTTNTGATCCAAATCCAACCCTCTTTCACCTCACTTGTACATTTTTCATTAG
 
. : . : . : . : . : . :
rJMSF050F21+ GGTAGATCACACTCATCATTTAGGGGCTCTTTTTGCTTCCTTTATTATTATTTTTTTCAT
                      ____________________________________________________________
consensus GGTAGATCACACTCATCATTTAGGGGCTCTTTTTGCTTCCTTTATTATTATTTTTTTCAT
 
. : . : . : . : . : . :
rJMSF050F21+ TTAGGATTTATATTATTATATATAAATAGTAGAAACCACAAAGCATGTATTAACACAAAT
                      ____________________________________________________________
consensus TTAGGATTTATATTATTATATATAAATAGTAGAAACCACAAAGCATGTATTAACACAAAT