Previous Contig 013883:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041K09Sequence200004625 (5)778013883 (2)gb:ZEL312053_17313757e-70Zinnia elegans mRNA for HD-Zip protein (hb1 gene).
JMSF050F19Sequence398004625 (5)703013883 (2)gb:ZEL312053_17313758e-70Zinnia elegans mRNA for HD-Zip protein (hb1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041K09+ GC
                      ____________________________________________________________
consensus GC
 
. : . : . : . : . : . :
rJMSF041K09+ GACANTGGCCCGACAATATGTCCGCAGTGTGATTTCATCTGTTCAAACGGGTTTGCAATG
                      ____________________________________________________________
consensus GACANTGGCCCGACAATATGTCCGCAGTGTGATTTCATCTGTTCAAACGGGTTTGCAATG
 
. : . : . : . : . : . :
rJMSF041K09+ GCGATATCTCCCATCGGGATCGGGTCCTGGTCTCGGCCCAAAGTTGTCCGCCATCTCCCC
rJMSF050F19+ GGATCGGGTCCTAGTCTCGGCCCAAAGTTGTCCGCCATCTCCCC
                      ____________________________________________________________
consensus GCGATATCTCCCATCGGGATCGGGTCCTGGTCTCGGCCCAAAGTTGTCCGCCATCTCCCC
 
. : . : . : . : . : . :
rJMSF041K09+ AGAAGCTCNTCCGCTGGCTCAGTGGATCTGCCAGAGCTATAGTTACCACATGGGAGCGGA
rJMSF050F19+ AGAAGCTCTTCCGCTGGCTCAGTGGATCTGCCAGAGCTATAGTTACCACATGGGAGCGGA
                      ____________________________________________________________
consensus AGAAGCTCTTCCGCTGGCTCAGTGGATCTGCCAGAGCTATAGTTACCACATGGGAGCGGA
 
. : . : . : . : . : . :
rJMSF041K09+ GTTGCTTGGTGNCGATTCTATGGGTGGTGAATCCGTGTTGAAGAATCTCTGGAACCATCA
rJMSF050F19+ GTTGCTTGGTGGCGATTCTATGGGTGGTGAATCCGTGTTGAAGAATCTCTGGAACCATCA
                      ____________________________________________________________
consensus GTTGCTTGGTGGCGATTCTATGGGTGGTGAATCCGTGTTGAAGAATCTCTGGAACCATCA
 
. : . : . : . : . : . :
rJMSF041K09+ TGATGCCATTTTGTGCTGCTCGGTAAAGTCGCTGCCGGTTTTCATATTTGCCAACAAGGC
rJMSF050F19+ TGATGCCATTTTGTGCTGCTCGGTAAAGTCGCTGCCGGTTTTCATATTTGCCAACAAGGC
                      ____________________________________________________________
consensus TGATGCCATTTTGTGCTGCTCGGTAAAGTCGCTGCCGGTTTTCATATTTGCCAACAAGGC
 
. : . : . : . : . : . :
rJMSF041K09+ TGGGCTTGACATGTTGGAGACAACATTAGTGGGCTTACAAGACATTGCTTTAGATAAAAT
rJMSF050F19+ TGGGCTTGACATGTTGGAGACAACATTAGTGGGCTTACAAGACATTGCTTTAGATAAAAT
                      ____________________________________________________________
consensus TGGGCTTGACATGTTGGAGACAACATTAGTGGGCTTACAAGACATTGCTTTAGATAAAAT
 
. : . : . : . : . : . :
rJMSF041K09+ ATTTGACGATTCTGGACGCAAGGCGTTGTATTCTGAACTTGCGAAAATCATGCAGCAGGG
rJMSF050F19+ ATTTGACGATTCTGGACGCAAGGCGTTGTATTCTGAACTTGCGAAAATCATGCAGCAGGG
                      ____________________________________________________________
consensus ATTTGACGATTCTGGACGCAAGGCGTTGTATTCTGAACTTGCGAAAATCATGCAGCAGGG
 
. : . : . : . : . : . :
rJMSF041K09+ CTATGCATACATGCCGGGTGGGATCTGCATGTCAGCAATGGGGCGACATGTTTCGTACGA
rJMSF050F19+ CTATGCATACATGCCGGGTGGGATCTGCATGTCAGCAATGGGGCGACATGTTTCGTACGA
                      ____________________________________________________________
consensus CTATGCATACATGCCGGGTGGGATCTGCATGTCAGCAATGGGGCGACATGTTTCGTACGA
 
. : . : . : . : . : . :
rJMSF041K09+ GCAGGCGATCGCGTGGAAAGTCCTCTTGGACGATGAAAACACCGTTCACTGTTTGGCGTT
rJMSF050F19+ GCAGGCGATCGCGTGGAAAGTCCTCTTGGACGATGAAAACACCGTTCACTGTTTGGCGTT
                      ____________________________________________________________
consensus GCAGGCGATCGCGTGGAAAGTCCTCTTGGACGATGAAAACACCGTTCACTGTTTGGCGTT
 
. : . : . : . : . : . :
rJMSF041K09+ CTCGTTTATAAACTGGTCGTTTGTGTAAGTCTGTCCCGATGCCCGGGAGGAGGGAGGGGA
rJMSF050F19+ CTCGTTTATAAACTGGTCGTTTGTGTAAGTCTGTCCCGATGCCCGGGAGGAGGGAGGGGA
                      ____________________________________________________________
consensus CTCGTTTATAAACTGGTCGTTTGTGTAAGTCTGTCCCGATGCCCGGGAGGAGGGAGGGGA
 
. : . : . : . : . : . :
rJMSF041K09+ AACCAGGTTTNGCTTAGAGGAAGTTTNGTAATGGTCTAAAACAGCAGCCAAATATTTTCA
rJMSF050F19+ AACCAGGTTTTGCTTAGAGGAAGTTTTGTAATGGTCTAAAACAGCAGCCAAATATTTTCA
                      ____________________________________________________________
consensus AACCAGGTTTTGCTTAGAGGAAGTTTTGTAATGGTCTAAAACAGCAGCCAAATATTTTCA
 
. : . : . : . : . : . :
rJMSF041K09+ CTGTGGTTAGATTTGGTGTATGCTTCTGATATTTGTAAANGCTGCCAGTGTAGCNTTTTT
rJMSF050F19+ -TGTGGTTAGATTTGGTGTATGCTTCTGATATTTGTAAATGCTGCCAGTGTAGCTTTTTT
                      ____________________________________________________________
consensus CTGTGGTTAGATTTGGTGTATGCTTCTGATATTTGTAAATGCTGCCAGTGTAGCTTTTTT
 
. : . : . : . : . : . :
rJMSF041K09+ ACATTTTATTTTTAGAGTTTGGTTCTTTGATGAGGCCAGGCCAAAACATTT
rJMSF050F19+ ACATTTTATTTTTAGAGTTTGGTTCTTTGATGAGGCCAGGCCAAAACATTTTCTGCTGCT
                      ____________________________________________________________
consensus ACATTTTATTTTTAGAGTTTGGTTCTTTGATGAGGCCAGGCCAAAACATTTTCTGCTGCT