Previous Contig 013879:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010F09Sequence140018666695013879 (3)gb:AB012245_15117662e-62Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19.>gb:BT005679_1638
JMSF034B14Sequence643007983 (2)gb:AB012245_15117661e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19.>gb:BT005679_1638687013879 (3)gb:AB012245_15117661e-57Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19.>gb:BT005679_1638
JMSF050E14Sequence675007983 (2)gb:AB012245_15117661e-72Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19.>gb:BT005679_1638767013879 (3)gb:AB012245_15117666e-68Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MRA19.>gb:BT005679_1638

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF010F09+ TCT
rJMSF050E14+ ATCGTAGAGTGGTGCAGTATAATATCTTGTCGGGAACTTCCATGTCT
                      ____________________________________________________________
consensus ATCGTAGAGTGGTGCAGTATAATATCTTGTCGGGAACTTCCATGTCT
 
. : . : . : . : . : . :
rJMSF010F09+ TGCCCCCATGTAGGCGGAGCCACCGCACTTCTCAAGGCCATTCATCCTGACTGGAGCAGT
rJMSF034B14+ CACCGCACTTCTCAAGGCCATTCATCCTGACTGGAGCAGT
rJMSF050E14+ TGCCCCCATGTAGGCGGAGCCACCGCACTTCTCAAGGCCATTCATCCTGACTGGAGCAGT
                      ____________________________________________________________
consensus TGCCCCCATGTAGGCGGAGCCACCGCACTTCTCAAGGCCATTCATCCTGACTGGAGCAGT
 
. : . : . : . : . : . :
rJMSF010F09+ GCTGCAATACGCTCAGCTCTTATTACTTCAGCTGGGTTGCGAAACAACGTGGGAAAGCAA
rJMSF034B14+ GCTGCAATACGCTCAGCTCTTATTACTTCAGCTGGGTTGCGAAACAACGTGGGAAAGCAA
rJMSF050E14+ GCTGCAATACGCTCAGCTCTTATTACTTCAGCTGGGTTGCGAAACAACGTGGGAAAGCAA
                      ____________________________________________________________
consensus GCTGCAATACGCTCAGCTCTTATTACTTCAGCTGGGTTGCGAAACAACGTGGGAAAGCAA
 
. : . : . : . : . : . :
rJMSF010F09+ ATAACTGATGCAAACGGCTCCCCAGCAGATCCATTCCAATTCGGGGGAGGACATTTTAGG
rJMSF034B14+ ATAACTGATGCAAACGGCTCCCCAGCAGATCCATTCCAATTCGGGGGAGGACATTTTAGG
rJMSF050E14+ ATAACTGATGCAAACGGCTCCCCAGCAGATCCATTCCAATTCGGGGGAGGACATTTTAGG
                      ____________________________________________________________
consensus ATAACTGATGCAAACGGCTCCCCAGCAGATCCATTCCAATTCGGGGGAGGACATTTTAGG
 
. : . : . : . : . : . :
rJMSF010F09+ CCATCCAAAGCTGCAGATCCTGGACTGGTTTACAACGCCTCATACACTGATTATCTTCTC
rJMSF034B14+ CCATCCAAAGCTGCAGATCCTGGACTGGTTTACAACGCCTCATACACTGATTATCTTCTC
rJMSF050E14+ CCATCCAAAGCTGCAGATCCTGGACTGGTTTACAACGCCTCATACACTGATTATCTTCTC
                      ____________________________________________________________
consensus CCATCCAAAGCTGCAGATCCTGGACTGGTTTACAACGCCTCATACACTGATTATCTTCTC
 
. : . : . : . : . : . :
rJMSF010F09+ TTCCTTTGTGCGTATGGAGTAAAGGGCGTCGTCCCATCCTTCAAGTGCCCCGAGAATGCT
rJMSF034B14+ TTCCTTTGTGCGTATGGAGTAAAGGGCGTCGTCCCATCCTTCAAGTGCCCCGAGAATGCT
rJMSF050E14+ TTCCTTTGTGCGTATGGAGTAAAGGGCGTCGTCCCATCCTTCAAGTGCCCCGAGAATGCT
                      ____________________________________________________________
consensus TTCCTTTGTGCGTATGGAGTAAAGGGCGTCGTCCCATCCTTCAAGTGCCCCGAGAATGCT
 
. : . : . : . : . : . :
rJMSF010F09+ GCTTCACCTTCCAACCTCAACTATCCCTCCGTTGCCATTCCCGAACTCAAAGGGAAAGTG
rJMSF034B14+ GCTTCACCTTCCAACCTCAACTATCCCTCCGTTGCCATTCCCGAACTCAAAGGGAAAGTG
rJMSF050E14+ GCTTCACCTTCCAACCTCAACTATCCCTCCGTTGCCATTCCCGAACTCAAAGGGAAAGTG
                      ____________________________________________________________
consensus GCTTCACCTTCCAACCTCAACTATCCCTCCGTTGCCATTCCCGAACTCAAAGGGAAAGTG
 
. : . : . : . : . : . :
rJMSF010F09+ ACTGTCAAGAGAACCGTCACAAATGTTGGCAGTGGCAAAAGTCTTTACTTTGCTAGAGTT
rJMSF034B14+ ACTGTCAAGAGAACCGTCACAAATGTTGGCAGTGGCAAAAGTCTTTACTTTGCTAGAGTT
rJMSF050E14+ ACTGTCAAGAGAACCGTCACAAATGTTGGCAGTGGCAAAAGTCTTTACTTTGCTAGAGTT
                      ____________________________________________________________
consensus ACTGTCAAGAGAACCGTCACAAATGTTGGCAGTGGCAAAAGTCTTTACTTTGCTAGAGTT
 
. : . : . : . : . : . :
rJMSF010F09+ CAGCCTCCATCGGGATTCTCTGTTGAGATCTCTCCTCCCATCCTGTACTTCAGTCACGCG
rJMSF034B14+ CAGCCTCCATCGGGATTCTCTGTTGAGATCTCTCCTCCCATCCTGTACTTCAGTCACGCG
rJMSF050E14+ CAGCCTCCATCGGGATTCTCTGTTGAGATCTCTCCTCCCATCCTGTACTTCAGTCACGCG
                      ____________________________________________________________
consensus CAGCCTCCATCGGGATTCTCTGTTGAGATCTCTCCTCCCATCCTGTACTTCAGTCACGCG
 
. : . : . : . : . : . :
rJMSF010F09+ GGCCAGACAAAGAGCTTTACTGTTACTGTTAAAGCACGCAGAGATATGAAGAAGAGCGTT
rJMSF034B14+ GGCCAGACAAAGAGCTTTACTGTTACTGTTAAAGCACGCAGAGATATGAAGAAGAGCGTT
rJMSF050E14+ GGCCAGACAAAGAGCTTTACTGTTACTGTTAAAGCACGCAGAGATATGAAGAAGAGCGTT
                      ____________________________________________________________
consensus GGCCAGACAAAGAGCTTTACTGTTACTGTTAAAGCACGCAGAGATATGAAGAAGAGCGTT
 
. : . : . : . : . : . :
rJMSF010F09+ GAGAAACACGAGTATGAGTTTGGATGGTTTACCTGGAATGATGGACTCCACAATGTTAGA
rJMSF034B14+ GAGAAACACGAGTATGAGTTTGGATGGTTTACCTGGAATGATGGACTCCACAATGTTAGA
rJMSF050E14+ GAGAAACACGAGTATGAGTTTGGATGGTTTACCTGGAATGATGGACTCCACAATGTTAGA
                      ____________________________________________________________
consensus GAGAAACACGAGTATGAGTTTGGATGGTTTACCTGGAATGATGGACTCCACAATGTTAGA
 
. : . : . : . : . : . :
rJMSF010F09+ AGTCCCATTGCAGTGTCATTAGCATAGTTTTTAGCATGACTTTTAGATCTCAGGCATTAT
rJMSF034B14+ AGTCCCATTGCAGTGTCATTAGCATAGTTTTTAGCATGACTTTTAGATCTCAGGCATTAT
rJMSF050E14+ AGTCCCATTGCAGTGTCATTAGCATAGTTTTTAGCATGACTTTTAGATCTCAGGCATTAT
                      ____________________________________________________________
consensus AGTCCCATTGCAGTGTCATTAGCATAGTTTTTAGCATGACTTTTAGATCTCAGGCATTAT
 
. : . : . : . : . : . :
rJMSF010F09+ TTTTTACCACCTTGGACTCTCATTAGACAGAT
rJMSF034B14+ TTTTTACCACCTTGGACTCTCATTAGACAGATTTAGTCTGAAATAAC
rJMSF050E14+ TTTTTACCACCTTGGACTCTCATTAGACAGATTTAGTCTGAAATAACAATGAAGAAAGAT
                      ____________________________________________________________
consensus TTTTTACCACCTTGGACTCTCATTAGACAGATTTAGTCTGAAATAACAATGAAGAAAGAT