Previous Contig 013878:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN038N14Sequence626013878 (2)gb:AE016959_10239203e-96Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07
JMSF050E02Sequence632020521756013878 (2)gb:AE016959_10239201e-83Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN038N14- CGCACAGGCAGGGTCATTCCAGAAAGTGTGATCTATAGCTATGG
                      ____________________________________________________________
consensus CGCACAGGCAGGGTCATTCCAGAAAGTGTGATCTATAGCTATGG
 
. : . : . : . : . : . :
JMFN038N14- AACTGTTCTGCTGGACCTTCTGAGTGGAAAGCATATACCCCCGAGCCGTGCTTTAGATTT
                      ____________________________________________________________
consensus AACTGTTCTGCTGGACCTTCTGAGTGGAAAGCATATACCCCCGAGCCGTGCTTTAGATTT
 
. : . : . : . : . : . :
JMFN038N14- GATAAGGGGAAAAAACATATTGTTGCTTATGGATTCGTCCTTGGAAGGACAATACGCCAA
                      ____________________________________________________________
consensus GATAAGGGGAAAAAACATATTGTTGCTTATGGATTCGTCCTTGGAAGGACAATACGCCAA
 
. : . : . : . : . : . :
JMFN038N14- TGAAGATGCTGCTGCATTGGTGGAACTTGCTTCCAAGTGCCTTCAGTATGAAGCTCGGGA
                      ____________________________________________________________
consensus TGAAGATGCTGCTGCATTGGTGGAACTTGCTTCCAAGTGCCTTCAGTATGAAGCTCGGGA
 
. : . : . : . : . : . :
JMFN038N14- CCGCCCGAATATCAAGTTCATTCTTACCGCTGTGGAACCCCTTGAAAAGCAGAAAGAGGT
rJMSF050E02+ TTACCGCTGTGGAA-CCCNTGAAAAGCAGAAAGAGGT
                      ____________________________________________________________
consensus CCGCCCGAATATCAAGTTCATTCTTACCGCTGTGGAACCCCTTGAAAAGCAGAAAGAGGT
 
. : . : . : . : . : . :
JMFN038N14- TGCATCACATGTTTTAATGGGTCTGACGAAAACCGCCCCTGCTGTGGTCCCCACCATGCT
rJMSF050E02+ TGCATCACATGTTTTAATGGGTCTGACGAAAACCGCCCCTGCTGTGGTCCCCACCATGCT
                      ____________________________________________________________
consensus TGCATCACATGTTTTAATGGGTCTGACGAAAACCGCCCCTGCTGTGGTCCCCACCATGCT
 
. : . : . : . : . : . :
JMFN038N14- TTCTCCTCTCGGGAAGGCATGTGTGAGGATGGACCTCACGGCTGTGCACGATATCTTGCT
rJMSF050E02+ TTCTCCTCTCGGGAAGGCATGTGTGAGGATGGACCTCACGGCTGTGCACGATATCTTGCT
                      ____________________________________________________________
consensus TTCTCCTCTCGGGAAGGCATGTGTGAGGATGGACCTCACGGCTGTGCACGATATCTTGCT
 
. : . : . : . : . : . :
JMFN038N14- TAAAACGGGTTATAAAGACGAGGAAGGTGCAGAAAATGAGCTTTCGTTCCAAGAATGGAC
rJMSF050E02+ TAAAACGGGTTATAAAGACGAGGAAGGTGCAGAAAATGAGCTTTCGTTCCAAGAATGGAC
                      ____________________________________________________________
consensus TAAAACGGGTTATAAAGACGAGGAAGGTGCAGAAAATGAGCTTTCGTTCCAAGAATGGAC
 
. : . : . : . : . : . :
JMFN038N14- ACAACAAGTGCAAGATATGCTGAACACGAAGAAATTTGGGGATATCGCTTTTAGGGACAA
rJMSF050E02+ ACAACAAGTGCAAGATATGCTGAACACGAAGAAATTTGGGGATATCGCTTTTAGGGACAA
                      ____________________________________________________________
consensus ACAACAAGTGCAAGATATGCTGAACACGAAGAAATTTGGGGATATCGCTTTTAGGGACAA
 
. : . : . : . : . : . :
JMFN038N14- GGACTTCAAGAGCGCAATTGAGTACTATTCAAAGTTGGTATCAATGATGCCCATCGCTTC
rJMSF050E02+ GGACTTCAAGAGCGCAATTGAGTACTATTCAAAGTTGGTATCAATGATGCCCATCGCTTC
                      ____________________________________________________________
consensus GGACTTCAAGAGCGCAATTGAGTACTATTCAAAGTTGGTATCAATGATGCCCATCGCTTC
 
. : . : . : . : . : . :
JMFN038N14- GGGTACTGTTTTTGTGAGGCGGGCGCTCTCTTACTTGATGAT
rJMSF050E02+ GGGTACTGTTTTTGTGAGGCGGGCGCTCTCTTACTTGATGATAGGGCAGCCAGAGCTCGC
                      ____________________________________________________________
consensus GGGTACTGTTTTTGTGAGGCGGGCGCTCTCTTACTTGATGATAGGGCAGCCAGAGCTCGC
 
. : . : . : . : . : . :
rJMSF050E02+ CCTCCGGGATGCAATGCAGGCGCAGGTCTGCTTGCCCGAGTGGCCAACCGCATTCTACAT
                      ____________________________________________________________
consensus CCTCCGGGATGCAATGCAGGCGCAGGTCTGCTTGCCCGAGTGGCCAACCGCATTCTACAT
 
. : . : . : . : . : . :
rJMSF050E02+ GCAGGCCCTCGCCCTCTCGAAGCTAGGAATGGAGACCGACGCCCAGGACATGCTCAACGA
                      ____________________________________________________________
consensus GCAGGCCCTCGCCCTCTCGAAGCTAGGAATGGAGACCGACGCCCAGGACATGCTCAACGA
 
. : . : . : . : . : . :
rJMSF050E02+ TGGAGCCTCCTTCGAAGCAAAGAAGCTAAACAGTTGGCGTAACTAAGTAATCCCGATTAT
                      ____________________________________________________________
consensus TGGAGCCTCCTTCGAAGCAAAGAAGCTAAACAGTTGGCGTAACTAAGTAATCCCGATTAT
 
. : . : . : . : . : . :
rJMSF050E02+ CCAATCCGTTTGTCTCTGTTAGATACATATATATATATACATTGTTAGCTGTTGATGAGG
                      ____________________________________________________________
consensus CCAATCCGTTTGTCTCTGTTAGATACATATATATATATACATTGTTAGCTGTTGATGAGG
 
. : . : . : . : . : . :
rJMSF050E02+ AAATCTGTAAGATGAGGGTTTGCATTTACAAAAAGTTGCCCTCTATTGTAGCCATGAGTA
                      ____________________________________________________________
consensus AAATCTGTAAGATGAGGGTTTGCATTTACAAAAAGTTGCCCTCTATTGTAGCCATGAGTA
 
. : . : . : . : . : . :
rJMSF050E02+ TAGTTCCATATAGTGTATACAGCATTGTTGTGGCGTTTGGCTAGGCTCTTTCGAAGCAAA
                      ____________________________________________________________
consensus TAGTTCCATATAGTGTATACAGCATTGTTGTGGCGTTTGGCTAGGCTCTTTCGAAGCAAA