Previous Contig 013867:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011H21Sequence563004360 (11)sp|O48560|CAT3_SOYBN1e-93Catalase 3 (EC 1.11.1.6).>gb:AF035254_1762858 Glycine max catalase (cat3) mRNA, 692013867 (9)sp|P49315|CAT1_NICPL3e-83Catalase isozyme 1 (EC 1.11.1.6) (Fragment).>pir|S48650|S48650 catalase (EC 1.11
JMFF018E03Sequence577004360 (11)sp|O48560|CAT3_SOYBN5e-99Catalase 3 (EC 1.11.1.6).>gb:AF035254_1762858 Glycine max catalase (cat3) mRNA, 785013867 (9)gb:NTU93244_1691926e-112Nicotiana tabacum catalase 1 (cat1) mRNA, complete cds.
JMFF031C05Sequence542004360 (11)sp|O48560|CAT3_SOYBN4e-91Catalase 3 (EC 1.11.1.6).>gb:AF035254_1762858 Glycine max catalase (cat3) mRNA, 766013867 (9)gb:NTU93244_1691926e-107Nicotiana tabacum catalase 1 (cat1) mRNA, complete cds.
JMSF014M16Sequence461004360 (11)sp|O48560|CAT3_SOYBN8e-73Catalase 3 (EC 1.11.1.6).>gb:AF035254_1762858 Glycine max catalase (cat3) mRNA, 762013867 (9)gb:NTU93244_1691926e-106Nicotiana tabacum catalase 1 (cat1) mRNA, complete cds.
JMSF020B05Sequence697004360 (11)sp|O48560|CAT3_SOYBNe-121Catalase 3 (EC 1.11.1.6).>gb:AF035254_1762858 Glycine max catalase (cat3) mRNA, 805013867 (9)gb:NTU93244_1691926e-110Nicotiana tabacum catalase 1 (cat1) mRNA, complete cds.
JMSF026K03Sequence695004360 (11)sp|O48560|CAT3_SOYBNe-120Catalase 3 (EC 1.11.1.6).>gb:AF035254_1762858 Glycine max catalase (cat3) mRNA, 723013867 (9)gb:NTU93244_1691926e-109Nicotiana tabacum catalase 1 (cat1) mRNA, complete cds.
JMSF033I02Sequence718004360 (11)sp|P17598|CAT1_GOSHIe-124Catalase isozyme 1 (EC 1.11.1.6).>pir|S10770|S10770 catalase (EC 1.11.1.6) - upl645013867 (9)sp|P49315|CAT1_NICPL5e-76Catalase isozyme 1 (EC 1.11.1.6) (Fragment).>pir|S48650|S48650 catalase (EC 1.11
JMSF037F06Sequence650004360 (11)sp|O48560|CAT3_SOYBNe-115Catalase 3 (EC 1.11.1.6).>gb:AF035254_1762858 Glycine max catalase (cat3) mRNA, 716013867 (9)gb:NTU93244_16919263e-96Nicotiana tabacum catalase 1 (cat1) mRNA, complete cds.
JMSF050A16Sequence716004360 (11)sp|P17598|CAT1_GOSHIe-124Catalase isozyme 1 (EC 1.11.1.6).>pir|S10770|S10770 catalase (EC 1.11.1.6) - upl676013867 (9)sp|P49315|CAT1_NICPL5e-76Catalase isozyme 1 (EC 1.11.1.6) (Fragment).>pir|S48650|S48650 catalase (EC 1.11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF018E03+ CTCGACGTGACCAAGACCTG
rJMSF020B05+ CCTG
                      ____________________________________________________________
consensus CTCGACGTGACCAAGACCTG
 
. : . : . : . : . : . :
rJMFF031C05+ CCGGAGGATCTGGTGCCGTTGCAGCCGGTGGGTCGCCTGGTTTTGAACAAGAACATTGA
rJMSF026K03+ CCGGAGGATCTGGTGCCGTTGCAGCCGGTGGGTCGCCTGGTTTTGAACAAGAACATTGA
rJMFF018E03+ GCCGGAGGATCTGGTGCCGTTGCAGCCGGTGGGTCGCCTGGTTTTGAACAAGAACATTGA
rJMSF014M16+ AGGATCTGGTGCCGTTGCAGCCGGTGGGTCGCCTGGTTTTGAACAAGAACATTGA
rJMSF037F06+ A
rJMSF020B05+ GCCGGAGGATCTGGTGCCGTTGCAGCCGGTGGGTCGCCTGGTTTTGAACAAGAACATTGA
                      ____________________________________________________________
consensus GCCGGAGGATCTGGTGCCGTTGCAGCCGGTGGGTCGCCTGGTTTTGAACAAGAACATTGA
 
. : . : . : . : . : . :
rJMFF031C05+ TAATTTCTTCAACGAGAACGAGCAGCTGGCATTTTGCCCGTCGATTGTGGTGCCCGGAAT
rJMSF026K03+ TAATTTCTTCAACGAGAACGAGCAGCTGGCATTTTGCCCGTCGATTGTGGTGCCCGGAAT
rJMFF018E03+ TAATTTCTTCAACGAGAACGAGCAGCTGGCATTTTGCCCGTCGATTGTGGTGCCCGGAAT
rJMSF014M16+ TAATTTCTTCAACGAGAACGAGCAGCTGGCATTTTGCCCGTCGATTGTGGTGCCCGGAAT
rJMSF037F06+ TAATTTCTTCAACGAGAACGAGCAGCTGGCATTTTGCCCGTCGATTGTGGTGCCCGGAAT
rJMSF020B05+ TAATTTCTTCAACGAGAACGAGCAGCTGGCATTTTGCCCGTCGATTGTGGTGCCCGGAAT
                      ____________________________________________________________
consensus TAATTTCTTCAACGAGAACGAGCAGCTGGCATTTTGCCCGTCGATTGTGGTGCCCGGAAT
 
. : . : . : . : . : . :
rJMFF031C05+ CTATTATTCCGACGATAAGCTGCTGCAGACTCGGATCTTCTCCTATTCCGATACCCAGAG
rJMSF026K03+ CTATTATTCCGACGATAAGCTGCTGCAGACTCGGATCTTCTCCTATTCCGATACCCAGAG
rJMFF018E03+ CTATTATTCCGACGATAAGCTGCTGCAGACTCGGATCTTCTCCTATTCCGATACCCAGAG
rJMSF014M16+ CTATTATTCCGACGATAAGCTGCTGCAGACTCGGATCTTCTCCTATTCCGATACCCAGAG
rJMSF037F06+ CTATTATTCCGACGATAAGCTGCTGCAGACTCGGATCTTCTCCTATTCCGATACCCAGAG
rJMSF020B05+ CTATTATTCCGACGATAAGCTGCTGCAGACTCGGATCTTCTCCTATTCCGATACCCAGAG
rJMSF033I02+ TATTCCGATACCCAGAG
rJMFF011H21+ TTATTCCGACGATAAGCTGCTGCAGACTCGGATCTTCTCCTATTCCGATACCCAGAG
rJMSF050A16+ TATTCCGATACCCAGAG
                      ____________________________________________________________
consensus CTATTATTCCGACGATAAGCTGCTGCAGACTCGGATCTTCTCCTATTCCGATACCCAGAG
 
. : . : . : . : . : . :
rJMFF031C05+ GTACCGGCTCGGCCCCAACTATCTGCAGCTGCCGGCGAATGCTCCCAAGTGTTCCATGCA
rJMSF026K03+ GTACCGGCTCGGCCCCAACTATCTGCAGCTGCCGGCGAATGCTCCCAAGTGTTCCATGCA
rJMFF018E03+ GTACCGGCTCGGCCCCAACTATCTGCAGCTGCCGGCGAATGCTCCCAAGTGTTCCATGCA
rJMSF014M16+ GTACCGGCTCGGCCCCAACTATCTGCAGCTGCCGGCGAATGCTCCCAAGTGTTCCATGCA
rJMSF037F06+ GTACCGGCTCGGCCCCAACTATCTGCAGCTGCCGGCGAATGCTCCCAAGTGTTCCATGCA
rJMSF020B05+ GTACCGGCTCGGCCCCAACTATCTGCAGCTGCCGGCGAATGCTCCCAAGTGTTCCATGCA
rJMSF033I02+ GTACCGGCTCGGCCCCAACTATCTGCAGCTGCCGGCGAATGCTCCCAAGTGTTCCATGCA
rJMFF011H21+ GTACCGGCTCGGCCCCAACTATCTGCAGCTGCCGGCGAATGCTCCCAAGTGTTCCATGCA
rJMSF050A16+ GTACCGGCTCGGCCCCAACTATCTGCAGCTGCCGGCGAATGCTCCCAAGTGTTCCATGCA
                      ____________________________________________________________
consensus GTACCGGCTCGGCCCCAACTATCTGCAGCTGCCGGCGAATGCTCCCAAGTGTTCCATGCA
 
. : . : . : . : . : . :
rJMFF031C05+ CAACAATCACTATGATGGGTCCATGAACTTCATGCACAGAGACGAAGAGATTGATTACTT
rJMSF026K03+ CAACAATCACTATGATGGGTCCATGAACTTCATGCACAGAGACGAAGAGATTGATTACTT
rJMFF018E03+ CAACAATCACTATGATGGGTCCATGAACTTCATGCACAGAGACGAAGAGATTGATTACTT
rJMSF014M16+ CAACAATCACTATGATGGGTCCATGAACTTCATGCACAGAGACGAAGAGATTGATTACTT
rJMSF037F06+ CAACAATCACTATGATGGGTCCATGAACTTCATGCACAGAGACGAAGAGATTGATTACTT
rJMSF020B05+ CAACAATCACTATGATGGGTCCATGAACTTCATGCACAGAGACGAAGAGATTGATTACTT
rJMSF033I02+ CAACAATCACTATGATGGGTCCATGAACTTCATGCACAGAGACGAAGAGATTGATTACTT
rJMFF011H21+ CAACAATCACTATGATGGGTCCATGAACTTCATGCACAGAGACGAAGAGATTGATTACTT
rJMSF050A16+ CAACAATCACTATGATGGGTCCATGAACTTCATGCACAGAGACGAAGAGATTGATTACTT
                      ____________________________________________________________
consensus CAACAATCACTATGATGGGTCCATGAACTTCATGCACAGAGACGAAGAGATTGATTACTT
 
. : . : . : . : . : . :
rJMFF031C05+ CCCTTCGAGGTATGATCCTGTGAGGCACGCTGAGAGGTACCCAACTCCTGCTGCAGTCTG
rJMSF026K03+ CCCTTCGAGGTATGATCCTGTGAGGCACGCTGAGAGGTACCCAACTCCTGCTGCAGTCTG
rJMFF018E03+ CCCTTCGAGGTATGATCCTGTGAGGCACGCTGAGAGGTACCCAACTCCTGCTGCAGTCTG
rJMSF014M16+ CCCTTCGAGGTATGATCCTGTGAGGCACGCTGAGAGGTACCCAACTCCTGCTGCAGTCTG
rJMSF037F06+ CCCTTCGAGGTATGATCCTGTGAGGCACGCTGAGAGGTACCCAACTCCTGCTGCAGTCTG
rJMSF020B05+ CCCTTCGAGGTATGATCCTGTGAGGCACGCTGAGAGGTACCCAACTCCTGCTGCAGTCTG
rJMSF033I02+ CCCTTCGAGGTATGATCCTGTGAGGCACGCTGAGAGGTACCCAACTCCTGCTGCAGTCTG
rJMFF011H21+ CCCTTCGAGGTATGATCCTGTGAGGCACGCTGAGAGGTACCCAACTCCTGCTGCAGTCTG
rJMSF050A16+ CCCTTCGAGGTATGATCCTGTGAGGCACGCTGAGAGGTACCCAACTCCTGCTGCAGTCTG
                      ____________________________________________________________
consensus CCCTTCGAGGTATGATCCTGTGAGGCACGCTGAGAGGTACCCAACTCCTGCTGCAGTCTG
 
. : . : . : . : . : . :
rJMFF031C05+ CACTGGCAAACGTGAGAAGTGTGTGATTGGGAAGGAGAACAATTTCAAGCAACCTGGGGA
rJMSF026K03+ CACTGGCAAACGTGAGAAGTGTGTGATTGGGAAGGAGAACAATTTCAAGCAACCTGGGGA
rJMFF018E03+ CACTGGCAAACGTGAGAAGTGTGTGATTGGGAAGGAGAACAATTTCAAGCAACCTGGGGA
rJMSF014M16+ CACTGGCAAACGTGAGAAGTGTGTGATTGGGAAGGAGAACAATTTCAAGCAACCTGGGGA
rJMSF037F06+ CACTGGCAAACGTGAGAAGTGTGTGATTGGGAAGGAGAACAATTTCAAGCAACCTGGGGA
rJMSF020B05+ CACTGGCAAACGTGAGAAGTGTGTGATTGGGAAGGAGAACAATTTCAAGCAACCTGGGGA
rJMSF033I02+ CACTGGCAAACGTGAGAAGTGTGTGATTGGGAAGGAGAACAATTTCAAGCAACCTGGGGA
rJMFF011H21+ CACTGGCAAACGTGAGAAGTGTGTGATTGGGAAGGAGAACAATTTCAAGCAACCTGGGGA
rJMSF050A16+ CACTGGCAAACGTGAGAAGTGTGTGATTGGGAAGGAGAACAATTTCAAGCAACCTGGGGA
                      ____________________________________________________________
consensus CACTGGCAAACGTGAGAAGTGTGTGATTGGGAAGGAGAACAATTTCAAGCAACCTGGGGA
 
. : . : . : . : . : . :
rJMFF031C05+ GAGATACCGTTCATTCTCACCAGACAGGCAGGAGAGGTTTATCTGCCGCTGGGTTGATGC
rJMSF026K03+ GAGATACCGTTCATTCTCACCAGACAGGCAGGAGAGGTTTATCTGCCGCTGGGTTGATGC
rJMFF018E03+ GAGATACCGTTCATTCTCACCAGACAGGCAGGAGAGGTTTATCTGCCGCTGGGTTGATGC
rJMSF014M16+ GAGATACCGTTCATTCTCACCAGACAGGCAGGAGAGGTTTATCTGCCGCTGGGTTGATGC
rJMSF037F06+ GAGATACCGTTCATTCTCACCAGACAGGCAGGAGAGGTTTATCTGCCGCTGGGTTGATGC
rJMSF020B05+ GAGATACCGTTCATTCTCACCAGACAGGCAGGAGAGGTTTATCTGCCGCTGGGTTGATGC
rJMSF033I02+ GAGATACCGTTCATTCTCACCAGACAGGCAGGAGAGGTTTATCTGCCGCTGGGTTGATGC
rJMFF011H21+ GAGATACCGTTCATTCTCACCAGACAGGCAGGAGAGGTTTATCTGCCGCTGGGTTGATGC
rJMSF050A16+ GAGATACCGTTCATTCTCACCAGACAGGCAGGAGAGGTTTATCTGCCGCTGGGTTGATGC
                      ____________________________________________________________
consensus GAGATACCGTTCATTCTCACCAGACAGGCAGGAGAGGTTTATCTGCCGCTGGGTTGATGC
 
. : . : . : . : . : . :
rJMFF031C05+ CTTGTCTGATCCAAGAATTACTTATGAGATTCGCAGTATTTGGATCTCGTACTGGTCTCA
rJMSF026K03+ CTTGTCTGATCCAAGAATTACTTATGAGATTCGCAGTATTTGGATCTCGTACTGGTCTCA
rJMFF018E03+ CTTGTCTGATCCAAGAATTACTTATGAGATTCGCAGTATTTGGATCTCGTACTGGTCTCA
rJMSF014M16+ CTTGTCTGATCCAAGAATTACTTATGAGATTCGCAGTATTTGGATCTCGTACTGGTCTCA
rJMSF037F06+ CTTGTCTGATCCAAGAATTACTTATGAGATTCGCAGTATTTGGATCTCGTACTGGTCTCA
rJMSF020B05+ CTTGTCTGATCCAAGAATTACTTATGAGATTCGCAGTATTTGGATCTCGTACTGGTCTCA
rJMSF033I02+ CTTGTCTGATCCAAGAATTACTTATGAGATTCGCAGTATTTGGATCTCGTACTGGTCTCA
rJMFF011H21+ CTTGTCTGATCCAAGAATTACTTATGAGATTCGCAGTATTTGGATCTCGTACTGGTCTCA
rJMSF050A16+ CTTGTCTGATCCAAGAATTACTTATGAGATTCGCAGTATTTGGATCTCGTACTGGTCTCA
                      ____________________________________________________________
consensus CTTGTCTGATCCAAGAATTACTTATGAGATTCGCAGTATTTGGATCTCGTACTGGTCTCA
 
. : . : . : . : . : . :
rJMFF031C05+ GGCTGATAAATCCTTGGGACAGAAGATTGCTTCCAGGCTGAACATGAGGCCAAACATGTG
rJMSF026K03+ GGCTGATAAATCCTTGGGACAGAAGATTGCTTCCAGGCTGAACATGAGGCCAAACATGTG
rJMFF018E03+ GGCTGATAAATCCTTGGGACAGAAGATTGCTTCCAGGCTGAACATGAGGCCAAACATGTG
rJMSF014M16+ GGCTGATAAATCCTTGGGACAGAAGATTGCTTCCAGGCTGAACATGAGGCCAAACATGTG
rJMSF037F06+ GGCTGATAAATCCTTGGGACAGAAGATTGCTTCCAGGCTGAACATGAGGCCAAACATGTG
rJMSF020B05+ GGCTGATAAATCCTTGGGACAGAAGATTGCTTCCAGGCTGAACATGAGGCCAAACATGTG
rJMSF033I02+ GGCTGATAAATCCTTGGGACAGAAGATTGCTTCCAGGCTGAACATGAGGCCAAACATGTG
rJMFF011H21+ GGCTGATAAATCCTTGGGACAGAAGATTGCTTCCAGGCTGAACATGAGGCCAAACATGTG
rJMSF050A16+ GGCTGATAAATCCTTGGGACAGAAGATTGCTTCCAGGCTGAACATGAGGCCAAACATGTG
                      ____________________________________________________________
consensus GGCTGATAAATCCTTGGGACAGAAGATTGCTTCCAGGCTGAACATGAGGCCAAACATGTG
 
. : . : . : . : . : . :
rJMFF031C05+ AAGAAGCTGTTGAAGGGGGTTGATCTCTGATCTTCTGATTCTTGATTTTAGCTGCTAGCT
rJMSF026K03+ AAGAAGCTGTTGAAGGGGGTTGATCTCTGATCTTCTGATTCTTGATTTTAGCTGCTAGCT
rJMFF018E03+ AAGAAGCTGTTGAAGGGGGTTGATCTCTGATCTTCTGATTCTTGATTTTAGCTGCTAGCT
rJMSF014M16+ AAGAAGCTGTTGAAGGGGGTTGATCTCTGATCTTCTGATTCTTGATTTTAGCTGCTAGCT
rJMSF037F06+ AAGAAGCTGTTGAAGGGGGTTGATCTCTGATCTTCTGATTCTTGATTTTAGCTGCTAGCT
rJMSF020B05+ AAGAAGCTGTTGAAGGGGGTTGATCTCTGATCTTCTGATTCTTGATTTTAGCTGCTAGCT
rJMSF033I02+ AAGAAGCTGTTGAAGGGGGTTGATCTCTGATCTTCTGATTCTTGATTTTAGCTGCTAGCT
rJMFF011H21+ AAGAAGCTGTTGAAGGGGGTTGATCTCTGATCTTCTGATTCTTGATTTTAGCTGCTAGCT
rJMSF050A16+ AAGAAGCTGTTGAAGGGGGTTGATCTCTGATCTTCTGATTCTTGATTTTAGCTGCTAGCT
                      ____________________________________________________________
consensus AAGAAGCTGTTGAAGGGGGTTGATCTCTGATCTTCTGATTCTTGATTTTAGCTGCTAGCT
 
. : . : . : . : . : . :
rJMFF031C05+ AATCTGTCTGTAATCCAGGCCGTCCATCACATTA-CAAGGACACATACATATATATTTTT
rJMSF026K03+ AATCTGTCTGTAATCCAGGCCGTCCATCACATTAGCAAGGACACATACATATATATTTT
rJMFF018E03+ AATCTGTCTGTAATCCAGGCCGTCCATCACATTA-CAAGGACACATACATATATATTTTT
rJMSF014M16+ AATCTGTCTGTAATCCAGGCCGTCCATCACATTA-CAAGGACACATACATATATATTTTT
rJMSF037F06+ AATCTGTCTGTAATCCAGGCCGTCCATCACATTA-CAAGGACACATACATATATATTTTT
rJMSF020B05+ AATCTGTCTGTAATCCAGGCCGTCCATCACATTA-CAAGGACACATACATATATATTTTT
rJMSF033I02+ AATCTGTCTGTAATCCAGGCCGTCCATCACATTA-CAAGGACACATACATATATATTTTT
rJMFF011H21+ AATCTGTCTGTAATCCAGGCCGTCCATCACATTA-CAAGGACACATACATATATATTTTT
rJMSF050A16+ AATCTGTCTGTAATCCAGGCCGTCCATCACATTA-CAAGGACACATACATATATATTTTT
                      ____________________________________________________________
consensus AATCTGTCTGTAATCCAGGCCGTCCATCACATTA-CAAGGACACATACATATATATTTTT
 
. : . : . : . : . : . :
rJMFF031C05+ GGGTTTTCTTTTTTGCTTGAATACAATGATGATGATATGATATGAT
rJMFF018E03+ GGGTTTTCTTTTTTGCTTGAATACAATGATGATGATATGATATGAT
rJMSF014M16+ GGGTTTTCTTTTTTGCTTGAATACAATGATGATGATATGATATGATGT
rJMSF037F06+ GGGTTTTCTTTTTTGCTTGAATACAATGATGATGATATGATATGATGTTGAGTTTT
rJMSF020B05+ GGGTTTTCTTTTTTGCTTGAATACAATGATGATGATATGATATGATGTTGAGTTTTGTGT
rJMSF033I02+ GGGTTTTCTTTTTTGCTTGAATACAATGATGATGATATGATATGATGTTGAGTTTTGTGT
rJMFF011H21+ GGGTTTTCTTTTTTGCTTGAATACAATGATGATGATATGATATGATGTTGAGTTTTGTGT
rJMSF050A16+ GGGTTTTCTTTTTTGCTTGAATACAATGATGATGATATGATATGATGTTGAGTTTTGTGT
                      ____________________________________________________________
consensus GGGTTTTCTTTTTTGCTTGAATACAATGATGATGATATGATATGATGTTGAGTTTTGTGT
 
. : . : . : . : . : . :
rJMSF020B05+ AATAAGAGTGTTGAA
rJMSF033I02+ AATAAGAGTNTTGAATTATAATATGGAAG
rJMFF011H21+ AATAAGAGTGTTGAATTATAATATGGAAG
rJMSF050A16+ AATAAGAGTGTTGAATTATAATATGGAAGTCCCCACTGCAAATACTTCCTTAGTTCCTCA
                      ____________________________________________________________
consensus AATAAGAGTGTTGAATTATAATATGGAAGTCCCCACTGCAAATACTTCCTTAGTTCCTCA