Previous Contig 013865:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF050A13Sequence648001115 (3)gb:AY054272_15630924e-56Arabidopsis thaliana At1g63980/F22C12_9 mRNA, complete cds.>gb:BT002689_1636292 614013865 (2)
JMSF052B09Sequence652001115 (3)gb:AY054272_15630921e-56Arabidopsis thaliana At1g63980/F22C12_9 mRNA, complete cds.>gb:BT002689_1636292 720013865 (2)gb:AY054272_15630925e-09Arabidopsis thaliana At1g63980/F22C12_9 mRNA, complete cds.>gb:BT002689_1636292

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052B09+ TGTTNTG
                      ____________________________________________________________
consensus TGTTNTG
 
. : . : . : . : . : . :
rJMSF052B09+ TGAGGAGGATCAAGAAAATCTCTATAAACNTGTTCAAGATAAATCCCCATCTGGAAAACN
                      ____________________________________________________________
consensus TGAGGAGGATCAAGAAAATCTCTATAAACNTGTTCAAGATAAATCCCCATCTGGAAAACN
 
. : . : . : . : . : . :
rJMSF052B09+ AGGGCTGGGCATCNAGGNCNAGCCCNAAAAGATAGCTGGTTGCTTNTTTCNGGGGAAAAA
rJMSF050A13+ TTTCAGGGGAAAAA
                      ____________________________________________________________
consensus AGGGCTGGGCATCNAGGNCNAGCCCNAAAAGATAGCTGGTTGCTTNTTTCAGGGGAAAAA
 
. : . : . : . : . : . :
rJMSF052B09+ GACNTCTTTTGATGACNGCGATGGGGAAGATTCCTCCGNTTCNAACTTGTCGNTGAAAGC
rJMSF050A13+ GACATCTTTTGATGACAGCGATGGGGAAGATTCCTCCGATTCAAACTTGTCGATGAAAGC
                      ____________________________________________________________
consensus GACATCTTTTGATGACAGCGATGGGGAAGATTCCTCCGATTCAAACTTGTCGATGAAAGC
 
. : . : . : . : . : . :
rJMSF052B09+ NAAAAATGATGAAATTTNCNAGTCNTGCGNGAATGATAACCCNAAAATGNAATTAAAGAA
rJMSF050A13+ AAAAAATGATGAAATTTACAAGTCCTGCGNGAATGNTAACCCNAAAATGAAATTAAAGAA
                      ____________________________________________________________
consensus AAAAAATGATGAAATTTACAAGTCCTGCGNGAATGATAACCCNAAAATGAAATTAAAGAA
 
. : . : . : . : . : . :
rJMSF052B09+ GTTGNGTAAACCCCTTNTTAAACCGGCCCCCGGGAATTCCNTGAAACTGAAGCNACTCAA
rJMSF050A13+ GTTGTGTAAACCCCTTNTTAAACCGGCCCCCGGGAATTCCNTGAAACTGAAGCNACTCAA
                      ____________________________________________________________
consensus GTTGTGTAAACCCCTTNTTAAACCGGCCCCCGGGAATTCCNTGAAACTGAAGCNACTCAA
 
. : . : . : . : . : . :
rJMSF052B09+ AGCTNTAATAGATGNGCNATCNTCNGCNGTTTTTGAGAACTTCTNTGAAAAAGNTGCTAT
rJMSF050A13+ AGTTNTAATAGNTGNGCNATCNTCNGCTGTTTTTGAGAACTTCTNTGAAAAAGNTGCTAT
                      ____________________________________________________________
consensus AGTTNTAATAGATGNGCNATCNTCNGCTGTTTTTGAGAACTTCTNTGAAAAAGNTGCTAT
 
. : . : . : . : . : . :
rJMSF052B09+ AGCTCNTTTAAAACNCNAGCTTGAAGGCNGNGNCNAGTTNTCNGTGGNGGGGAAGCGAGN
rJMSF050A13+ AGCTCNTTTAAAACGCNAGCNTGAAGGCNGNGACNAGTTNTCNGNGGNGGGGAAGCGAGN
                      ____________________________________________________________
consensus AGCTCNTTTAAAACGCNAGCTTGAAGGCNGNGACNAGTTNTCNGTGGNGGGGAAGCGAGN
 
. : . : . : . : . : . :
rJMSF052B09+ GTCTNTAACNTGAAAGAGTGGCTGAAAAGAATTTTGCTTNGTAAGGNGATAGCTGTACCN
rJMSF050A13+ GTCTCTAACNTGAAAGAGNGGCTGAAAAGAATTTTGCTTNGTAAGGNGATAGCTGTACCN
                      ____________________________________________________________
consensus GTCTCTAACNTGAAAGAGTGGCTGAAAAGAATTTTGCTTNGTAAGGNGATAGCTGTACCN
 
. : . : . : . : . : . :
rJMSF052B09+ CNATGTACCTTGNTGNTGNGNCTAGTTTGGGNGTGATATACCNAATTAAACCNTAATGNG
rJMSF050A13+ CNATGTACNTTGTTGCTGNGACTAGTTTGGGTGTGATATACCNAATTNAACCNTAATGNG
                      ____________________________________________________________
consensus CNATGTACCTTGTTGCTGNGACTAGTTTGGGTGTGATATACCNAATTAAACCNTAATGNG
 
. : . : . : . : . : . :
rJMSF052B09+ GCNAGTCNTGATTTATTCCCCNGTAGTCCCTTTGTTGCNGATTTGTTTTTGGCTGNGAAT
rJMSF050A13+ GCNAGTCNTGATTTATTCCCCNGTAGTCCCTTTGTTGCNGATTTGTTTTTGGCTGNGAAT
                      ____________________________________________________________
consensus GCNAGTCNTGATTTATTCCCCNGTAGTCCCTTTGTTGCNGATTTGTTTTTGGCTGNGAAT
 
. : . : . : . : . : . :
rJMSF052B09+ TGGATATATAGCTACNGAACNAAACCGNGATCTTCCTNTGCNTCNTTGNTTTTTTTTTTG
rJMSF050A13+ TGGATATATAGCTACCGAACNAAACCGNGATCTTCCTNTGCNTCCTTGTTTTTTTTTTTG
                      ____________________________________________________________
consensus TGGATATATAGCTACCGAACNAAACCGNGATCTTCCTNTGCNTCCTTGTTTTTTTTTTTG
 
. : . : . : . : . : . :
rJMSF052B09+ TTTATTTTTAATAGTAT-TTCGGAGGTAAGGAATANGTTTATTT
rJMSF050A13+ TTTATTTTTAATAGTATCTTCGGAGGTAAGGAATNGGTTTATTTNTCGTTGNAGATTAAA
                      ____________________________________________________________
consensus TTTATTTTTAATAGTATCTTCGGAGGTAAGGAATAGGTTTATTTNTCGTTGNAGATTAAA