Previous Contig 013863:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046K19Sequence644004706 (6)sp|P60300|CLCG_ARATH2e-63Putative chloride channel-like protein CLC-G.537013863 (5)sp|P60300|CLCG_ARATH6e-42Putative chloride channel-like protein CLC-G.
JMSF017O08Sequence483004706 (6)sp|P60300|CLCG_ARATH2e-38Putative chloride channel-like protein CLC-G.613013863 (5)sp|P60300|CLCG_ARATH3e-62Putative chloride channel-like protein CLC-G.
JMSF036K07Sequence717004706 (6)sp|P60300|CLCG_ARATH3e-69Putative chloride channel-like protein CLC-G.746013863 (5)sp|P60300|CLCG_ARATH1e-83Putative chloride channel-like protein CLC-G.
JMSF049P22Sequence688013863 (5)sp|P60300|CLCG_ARATH3e-77Putative chloride channel-like protein CLC-G.769013863 (5)sp|P60300|CLCG_ARATH5e-49Putative chloride channel-like protein CLC-G.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049P22- TAGATTCTGAATTCCATCTCTTATCAATGCTAATTTTCTTTGTCACCTGC
                      ____________________________________________________________
consensus TAGATTCTGAATTCCATCTCTTATCAATGCTAATTTTCTTTGTCACCTGC
 
. : . : . : . : . : . :
JMSF049P22- TTCTTCCTCAGTATCTTTAGTTACGGAATTGTAGCTCCTACGGGTCTTTTTGTACCTGTG
                      ____________________________________________________________
consensus TTCTTCCTCAGTATCTTTAGTTACGGAATTGTAGCTCCTACGGGTCTTTTTGTACCTGTG
 
. : . : . : . : . : . :
JMSF049P22- ATTGTAACAGGTGCGGCTTATGGAAGATTTGTTGGGATGATAGTTAGTGGACGGTCAAAT
                      ____________________________________________________________
consensus ATTGTAACAGGTGCGGCTTATGGAAGATTTGTTGGGATGATAGTTAGTGGACGGTCAAAT
 
. : . : . : . : . : . :
JMSF049P22- CTAAACCATGGTCTCTTTGCAGTTCTAGGTTCTGCTTCTCTTCTTGGAGGATCTATGAGG
                      ____________________________________________________________
consensus CTAAACCATGGTCTCTTTGCAGTTCTAGGTTCTGCTTCTCTTCTTGGAGGATCTATGAGG
 
. : . : . : . : . : . :
JMSF049P22- GCAACTGTTTCTTTATGTATAATTATCCTTGAACTGACCAATAACCTATTATTACTACCA
                      ____________________________________________________________
consensus GCAACTGTTTCTTTATGTATAATTATCCTTGAACTGACCAATAACCTATTATTACTACCA
 
. : . : . : . : . : . :
JMSF049P22- CTCATAATGCTAGTTCTTCTTGTATCTAAAACAGTGGCAGATTCATTTAATGGAAATATT
rJMSF036K07+ TAAANCAGTGGCAGATTCATTTAATGGAAATATT
                      ____________________________________________________________
consensus CTCATAATGCTAGTTCTTCTTGTATCTAAAACAGTGGCAGATTCATTTAATGGAAATATT
 
. : . : . : . : . : . :
JMSF049P22- TACGACCTGTTAGTGCAAGCAAAGGGTTTTCCATATCTAGAAGCTCATGCAGAGCCATAT
rJMSF036K07+ TACGACCTGTTAGTGCAAGCAAAGGGTTTTCCATATCTAGAAGCTCATGCAGAGCCATAT
                      ____________________________________________________________
consensus TACGACCTGTTAGTGCAAGCAAAGGGTTTTCCATATCTAGAAGCTCATGCAGAGCCATAT
 
. : . : . : . : . : . :
JMSF049P22- ATGAGGCAACTTACTGTCAGTGATGTGGTCACAGGGCCACTTCAATTTTTCCATGGCATT
rJMSF036K07+ ATGAGGCAACTTACTGTCAGTGATGTGGTCACAGGGCCACTTCAATTTTTCCATGGCATT
rJMSF017O08+ TTCAATTTTTCCATGGCATT
rJMSF049P22+ TACTGTCAGTGATGTGGTCACAGGGCCACTTCAATTTTTCCATGGCATT
                      ____________________________________________________________
consensus ATGAGGCAACTTACTGTCAGTGATGTGGTCACAGGGCCACTTCAATTTTTCCATGGCATT
 
. : . : . : . : . : . :
JMSF049P22- GAGAAGGTCAGTAATATAGTTCATGTCCTAAGAACCACAGGGCATAATGGGTTTCCTGTG
rJMSF036K07+ GAGAAGGTCAGTAATATAGTTCATGTCCTAAGAACCACAGGGCATAATGGGTTTCCTGTG
rJMSF017O08+ GAGAAGGTCAGTAATATAGTTCATGTCCTAAGAACCACAGGGCATAATGGGTTTCCTGTG
rJMSF049P22+ GAGAAGGTCAGTAATATAGTTCATGTCCTNAGAACCACAGGGCATAATGGGTTTCCTGTG
                      ____________________________________________________________
consensus GAGAAGGTCAGTAATATAGTTCATGTCCTAAGAACCACAGGGCATAATGGGTTTCCTGTG
 
. : . : . : . : . : . :
JMSF049P22- CTGGATGAGCTTCCACTATCTGAATCCCCAATTTTGTCTGGTTTGATCCTTCGTGCCCAT
rJMSF036K07+ CTGGATGAGCTTCCACTATCTGAATCCCCAATTTTGTCTGGTTTGATCCTTCGTGCCCAT
rJMSF017O08+ CTGGATGAGCTTCCACTATCTGAATCCCCAATTTTGTCTGGTTTGATCCTTCGTGCCCAT
rJMSF049P22+ CTGGATGAGCTTCCACTATCTGAATCCCCAATTTTGTCTGGTTTGATCCTTCGTGCCCAT
                      ____________________________________________________________
consensus CTGGATGAGCTTCCACTATCTGAATCCCCAATTTTGTCTGGTTTGATCCTTCGTGCCCAT
 
. : . : . : . : . : . :
JMSF049P22- CTTATTACATTGTTAAAGCAGAAAGCCTTTTTGCATGATCCTGTGTGTATTAGCGAGTTT
rJMSF036K07+ CTTATTACATTGTTAAAGCAGAAAGCCTTTTTGCATGATCCTGTGTGTATTAGCGAGTTT
rJMSF017O08+ CTTATTACATTGTTAAAGCAGAAAGCCTTTTTGCATGATCCTGTGTGTATTAGCGAGTNT
rJMFF046K19+ TATTACATTG-TAAAGCAGAAAGCCTTTTTGCATGATCCTGTGTGTATTAGCGAGTTT
rJMSF049P22+ CTTATTACATTGTTAAAGCAGAAAGCCTTTTTGCATGATCCTGTGTGTATTAGCGAGTTT
                      ____________________________________________________________
consensus CTTATTACATTGTTAAAGCAGAAAGCCTTTTTGCATGATCCTGTGTGTATTAGCGAGTTT
 
. : . : . : . : . : . :
JMSF049P22- GCCGTTGATGAGTTCTCTCCAGATGATTTTGCAAAGAA
rJMSF036K07+ GCCGTTGATGAGTTCTCTCCAGATGATTTTGCAAAGAAGGGTTTGGGCCATGGAGACAGA
rJMSF017O08+ GCCGTTGATGAGTTCTCTCCAGATGATTTTGCAAAGAAGGGTTTGGGCCATGGAGACAGA
rJMFF046K19+ GCCGTTGATGAGTTCTCTCCAGATGATTTTGCAAAGAAGGGTTTGGGCCATGGAGACAGA
rJMSF049P22+ GCCGTTGATGAGTTCTCTCCAGATGATTTTGCAAAGAAGGGTTTGAGCCATGGAGACAGA
                      ____________________________________________________________
consensus GCCGTTGATGAGTTCTCTCCAGATGATTTTGCAAAGAAGGGTTTGGGCCATGGAGACAGA
 
. : . : . : . : . : . :
rJMSF036K07+ ATTGAAGACATTATATTGACAGATGAAGAAATGGAAATGTATATAGATCTGCATCATTTT
rJMSF017O08+ ATTGAAGACATTATATTGACAGATGAAGAAATGGAAATGTATATAGATCTGCATCATTTT
rJMFF046K19+ ATTGAAGACATTATATTGACAGATGAAGAAATGGAAATGTATATAGATCTGCATCATTTT
rJMSF049P22+ ATTGAAGACATTATATTGACAGATGAAGAAATGGAAATGTATATAGATCTGCATCATTTT
                      ____________________________________________________________
consensus ATTGAAGACATTATATTGACAGATGAAGAAATGGAAATGTATATAGATCTGCATCATTTT
 
. : . : . : . : . : . :
rJMSF036K07+ ACCAATGCTTCACCATATACTGTTCTTGAGACGATGTCCTTATCAAAGGCTCGCACACTC
rJMSF017O08+ ACCAATGCTTCACCATATACTGTTCTTGAGACGATGTCCTTATCAAAGGCTCGCACACTC
rJMFF046K19+ ACCAATGCTTCACCATATACTGTTCTTGAGACGATGTCCTTATCAAAGGCTCGCACACTC
rJMSF049P22+ ACCAATGCTTCACCATATACTGTTCTTGAGACGATGTCCTTATCAAAGGCTCGCACACTC
                      ____________________________________________________________
consensus ACCAATGCTTCACCATATACTGTTCTTGAGACGATGTCCTTATCAAAGGCTCGCACACTC
 
. : . : . : . : . : . :
rJMSF036K07+ TTCAGGCAACTTGGTTTAAGGCACTTGCTGGTGGTTCCACAGATTCCCGGT
rJMSF017O08+ TTCAGGCAACTTGGTTTAAGGCACTTGCTGGTGGTTCCACAGATTCCCGGT
rJMFF046K19+ TTCAGGCAACTTGGTTTAAGGCACTTGCTGGTGGTTCCACAGATTCCCGGT
rJMSF049P22+ TTCAGGCAACTTGGTTTAAGGCACTTGCTGGTGGTTCCACAGATTCCCGGTGTAAGTACT
                      ____________________________________________________________
consensus TTCAGGCAACTTGGTTTAAGGCACTTGCTGGTGGTTCCACAGATTCCCGGTGTAAGTACT
 
. : . : . : . : . : . :
rJMSF049P22+ TTACCCTGCCACCCCCGAGGCCCTGAGCTGTTCTTTTCTATGTTGTTAATGTTTTATGCG
                      ____________________________________________________________
consensus TTACCCTGCCACCCCCGAGGCCCTGAGCTGTTCTTTTCTATGTTGTTAATGTTTTATGCG
 
. : . : . : . : . : . :
rJMSF049P22+ AGAAACATTTTAGTCTTCATCAAGTATGCGTTTACACTATCGTTTTGCTTATTTCCAGAG
                      ____________________________________________________________
consensus AGAAACATTTTAGTCTTCATCAAGTATGCGTTTACACTATCGTTTTGCTTATTTCCAGAG
 
. : . : . : . : . : . :
rJMSF049P22+ ATTACCAGTAGTGGGTATCATGACAAGGCACGACTTCATGCCAGAACATGTGCTGAATCT
                      ____________________________________________________________
consensus ATTACCAGTAGTGGGTATCATGACAAGGCACGACTTCATGCCAGAACATGTGCTGAATCT
 
. : . : . : . : . : . :
rJMSF049P22+ TCATCCATCCATGGCACTAAGCAGGTGGAAAAGGTTGAGATTCCAGATGCCTCGCTGGAA
                      ____________________________________________________________
consensus TCATCCATCCATGGCACTAAGCAGGTGGAAAAGGTTGAGATTCCAGATGCCTCGCTGGAA
 
. : . : . : . : . : . :
rJMSF049P22+ TAAGCTGTTCTAACAAAGGAAGGTTAACGAGATTGTTTCATAGTTTGTCACTTGAGAGTG
                      ____________________________________________________________
consensus TAAGCTGTTCTAACAAAGGAAGGTTAACGAGATTGTTTCATAGTTTGTCACTTGAGAGTG