Previous Contig 013861:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007F08Sequence370003443 (2)776013861 (2)gb:AY080657_15683895e-60Arabidopsis thaliana unknown protein (At1g09990) mRNA, complete cds.>gb:AY123021
JMSF049P13Sequence676020512759013861 (2)gb:AY080657_15683892e-59Arabidopsis thaliana unknown protein (At1g09990) mRNA, complete cds.>gb:AY123021

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007F08+ GGCCACATCTNGNTACTGTACAGTTCAATTCTTTATTTAATTCTGGGCTATGGCTTT
rJMSF049P13+ TACAGTTCAAATTCTTATTTAATTCTGGGCTATGGCTTT
                      ____________________________________________________________
consensus GGCCACATCTNGNTACTGTACAGTTCAATTTTTTATTTAATTCTGGGCTATGGCTTT
 
. : . : . : . : . : . :
rJMSF007F08+ GAAGAAGCTCAAGGGCACACAGTGCATTCATCAGCTTACGTTTACAGATGATCCTGATAT
rJMSF049P13+ GAAGNAGCTCAAGGGCACACAGTGCATTCATCAGCTTACGTTTACAGATGATCCTGATAT
                      ____________________________________________________________
consensus GAAGAAGCTCAAGGGCACACAGTGCATTCATCAGCTTACGTTTACAGATGATCCTGATAT
 
. : . : . : . : . : . :
rJMSF007F08+ ACAAAATACATTCTTGTACAAACTTTGCAAGCGGAAGACCTTGGAGAACTTCAGGAATAT
rJMSF049P13+ ACAAAATACATTCTTGTACAAACTTTGCAAGCGGAAGACCTTGGAGAACTTCAGGAATAT
                      ____________________________________________________________
consensus ACAAAATACATTCTTGTACAAACTTTGCAAGCGGAAGACCTTGGAGAACTTCAGGAATAT
 
. : . : . : . : . : . :
rJMSF007F08+ TATTCTGTTATCTTCACCACAGGATGGTTACGTTCCATATCATTCTGCTAGGATTGAGAT
rJMSF049P13+ TATTCTGTTATCTTCACCACAGGATGGTTACGTTCCATATCATTCTGCTAGGATTGAGAT
                      ____________________________________________________________
consensus TATTCTGTTATCTTCACCACAGGATGGTTACGTTCCATATCATTCTGCTAGGATTGAGAT
 
. : . : . : . : . : . :
rJMSF007F08+ GTGCCAAGCATCTTCGGCAGACAGCTCAAAGAAGGGAAAAGTATTTATGGAGATGCTCAA
rJMSF049P13+ GTGCCAAGCATCTTCGGCAGACAGCTCAAAGAAGGGAAAAGTATTTATGGAGATGCTCAA
                      ____________________________________________________________
consensus GTGCCAAGCATCTTCGGCAGACAGCTCAAAGAAGGGAAAAGTATTTATGGAGATGCTCAA
 
. : . : . : . : . : . :
rJMSF007F08+ CCATTGCTTAGACCAGATACGCTCTCCTTCACACGATCATCGGGTTTTCATGCGATGCGA
rJMSF049P13+ CCATTGCTTAGACCAGATACGCTCTCCTTCACACGATCATCGGGTTTTCATGCGATGCGA
                      ____________________________________________________________
consensus CCATTGCTTAGACCAGATACGCTCTCCTTCACACGATCATCGGGTTTTCATGCGATGCGA
 
. : . : . : . : . : . :
rJMSF007F08+ TGTTAATTTCGATACGTCCTTGCAGGGGAGGAACTTGAACACCATGATAGGAAGGGCAGC
rJMSF049P13+ TGTTAATTTCGATACGTCCTTGCAGGGGAGGAACTTGAACACCATGATAGGAAGGGCAGC
                      ____________________________________________________________
consensus TGTTAATTTCGATACGTCCTTGCAGGGGAGGAACTTGAACACCATGATAGGAAGGGCAGC
 
. : . : . : . : . : . :
rJMSF007F08+ TCACATCGAGTTTCTGGAATCAGACACTTTTGTGAAATTCATAATGTGGTCATTTCCAGA
rJMSF049P13+ TCACATCGAGTTTCTGGAATCAGACACTTTTGTGAAATTCATAATGTGGTCATTTCCAGA
                      ____________________________________________________________
consensus TCACATCGAGTTTCTGGAATCAGACACTTTTGTGAAATTCATAATGTGGTCATTTCCAGA
 
. : . : . : . : . : . :
rJMSF007F08+ AGTATTCCGTTGATTATTTGGGAGCTTTTCCATTCCCTAAATCTTCACATCCAGAGCCTG
rJMSF049P13+ AGTATTCCGTTGATTATTTGGGAGCTTTTCCATTCCCTAAATCTTCACATCCAGAGCCTG
                      ____________________________________________________________
consensus AGTATTCCGTTGATTATTTGGGAGCTTTTCCATTCCCTAAATCTTCACATCCAGAGCCTG
 
. : . : . : . : . : . :
rJMSF007F08+ CCTATAGTGCACATGAACAGTTCTGGATGCCCATTTTCATCTCCAGCGCATTTGGTGCTC
rJMSF049P13+ CCTATAGTGCACATGAACAGTTCTGGATGCCCATTTTCATCTCCAGCGCATTTGGTGCTC
                      ____________________________________________________________
consensus CCTATAGTGCACATGAACAGTTCTGGATGCCCATTTTCATCTCCAGCGCATTTGGTGCTC
 
. : . : . : . : . : . :
rJMSF007F08+ TGAATTATTTGCCTCAAGTCACTCCATATTAACCTAATAGCTAATATAAGGTTTTTACTC
rJMSF049P13+ TGAATTATTTGCCTCAAGTCACTCCATATTAACCTAATAGCTAATATAAGGTTTTTACTC
                      ____________________________________________________________
consensus TGAATTATTTGCCTCAAGTCACTCCATATTAACCTAATAGCTAATATAAGGTTTTTACTC
 
. : . : . : . : . : . :
rJMSF007F08+ CTGAAGGGCAGTTTTACTCGCTGCAAACTGCACTTTGTAGCAATGAACCACTTAAAAAAA
rJMSF049P13+ CTGAAGGGCAGTTTTACTCGCTGCAAACTGCACTTTGTAGCAATGAACCACTTAAAAAAA
                      ____________________________________________________________
consensus CTGAAGGGCAGTTTTACTCGCTGCAAACTGCACTTTGTAGCAATGAACCACTTAAAAAAA
 
. : . : . : . : . : . :
rJMSF007F08+ TACTGGGTTTCAAACTTCTTCGTATAGTTTAGAATCAGATAGGTATAATTCTCCAAATC
rJMSF049P13+ TACTGGGTTTCAAACTTCTTCGTATAGTTTAGAATCAGATAGGTATAATTCTCCAAATCT
                      ____________________________________________________________
consensus TACTGGGTTTCAAACTTCTTCGTATAGTTTAGAATCAGATAGGTATAATTCTCCAAATCT