Previous Contig 013859:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF049P05Sequence664013859 (2)760013859 (2)gb:AB007651_15102596e-04Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD9.>gb:AY056427_15637

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049P05- TGAGATCAACTAAATGTTGTATTTCAGAGACATAATAGCAAT
                      ____________________________________________________________
consensus TGAGATCAACTAAATGTTGTATTTCAGAGACATAATAGCAAT
 
. : . : . : . : . : . :
JMSF049P05- GCGAAATCCGATTTAGTCTCTGAACATGAACCCTAGGTTTTGTACTTCATTGTTCGTAAT
                      ____________________________________________________________
consensus GCGAAATCCGATTTAGTCTCTGAACATGAACCCTAGGTTTTGTACTTCATTGTTCGTAAT
 
. : . : . : . : . : . :
JMSF049P05- TTCTGTGGATTAAAAGTTCAGTTCTGTCATTTTGGAGTACCGATCATCATCAGTTCATAA
                      ____________________________________________________________
consensus TTCTGTGGATTAAAAGTTCAGTTCTGTCATTTTGGAGTACCGATCATCATCAGTTCATAA
 
. : . : . : . : . : . :
JMSF049P05- AATTAAAGTTTGACAATGATCGCACCGTCTGTCGAAAACCCCAACTGAGATAAGTTAACT
                      ____________________________________________________________
consensus AATTAAAGTTTGACAATGATCGCACCGTCTGTCGAAAACCCCAACTGAGATAAGTTAACT
 
. : . : . : . : . : . :
JMSF049P05- TATTCCTTCAATTGCTTTCAGTTGATTTACTCTTAATTTAGTTATAGATTTGTCCAAATG
rJMSF049P05+ ATTTAGTTATAGA-TTGTCCAAATG
                      ____________________________________________________________
consensus TATTCCTTCAATTGCTTTCAGTTGATTTACTCTTAATTTAGTTATAGATTTGTCCAAATG
 
. : . : . : . : . : . :
JMSF049P05- TTTTTGTGTTCGTTAGATTAAGAAATTATTGTTGGTTTATTCGTGTATTTTAATTACGAT
rJMSF049P05+ -TTTTGTG-TCGTTAGATTAAGAAATTATTGGTGGTTTATTCGTGTATTTTAATTACGAT
                      ____________________________________________________________
consensus TTTTTGTGTTCGTTAGATTAAGAAATTATTGTTGGTTTATTCGTGTATTTTAATTACGAT
 
. : . : . : . : . : . :
JMSF049P05- TTTACTAAAAAATTTAGAGGAAATTTTTTTAAAACTTTCTCTGAAGTTTTCCTGTATTTA
rJMSF049P05+ TTTACTAAAAAATTTAGAGGAAATTTTTTTAAAACTTTCTCTGAAGTTTTCCTGTATTTA
                      ____________________________________________________________
consensus TTTACTAAAAAATTTAGAGGAAATTTTTTTAAAACTTTCTCTGAAGTTTTCCTGTATTTA
 
. : . : . : . : . : . :
JMSF049P05- GGTAAATATTTATGAAGGATTTAGGATTTGAAAATATTTATTATGCTCTCAGATAGTTTA
rJMSF049P05+ GGTAAATATTTATGAAGGATTTAGGATTTGAAAATATTTATTATGCTCTCAGATAGTTTA
                      ____________________________________________________________
consensus GGTAAATATTTATGAAGGATTTAGGATTTGAAAATATTTATTATGCTCTCAGATAGTTTA
 
. : . : . : . : . : . :
JMSF049P05- TGCTCATAATTAATATTATAATTCAACATGCAACTGAAAATAATTAGTTAAATTGAAGTC
rJMSF049P05+ TGCTCATAATTAATATTATAATTCAACATGCAACTGAAAATAATTAGTTAAATTGAAGTC
                      ____________________________________________________________
consensus TGCTCATAATTAATATTATAATTCAACATGCAACTGAAAATAATTAGTTAAATTGAAGTC
 
. : . : . : . : . : . :
JMSF049P05- ATTTATTTTATTACAGAGCAGGAATATTAACAAAACTATCATTCTAAGAGGCATTCAAGA
rJMSF049P05+ ATTTATTTTATTACAGAGCAGGAATATTAACAAAACTATCATTCTAAGAGGCATTCAAGA
                      ____________________________________________________________
consensus ATTTATTTTATTACAGAGCAGGAATATTAACAAAACTATCATTCTAAGAGGCATTCAAGA
 
. : . : . : . : . : . :
JMSF049P05- ACTGAATAAAAGAACACATGATCAGAGATTGAAGTCATGCGGGGACTTGAAAGTGCTTAT
rJMSF049P05+ ACTGAATAAAAGAACACATGATCAGAGATTGAAGTCATGCGGGGACTTG-AAGTGCTTAT
                      ____________________________________________________________
consensus ACTGAATAAAAGAACACATGATCAGAGATTGAAGTCATGCGGGGACTTGAAAGTGCTTAT
 
. : . : . : . : . : . :
JMSF049P05- CAATAGCCCAGAACAAACTTCA
rJMSF049P05+ CAATAGCCCAGAACAAACTTCAGAGTTTGAAAGGAATTGAAGGCTTCAGTAAACTAACTA
                      ____________________________________________________________
consensus CAATAGCCCAGAACAAACTTCAGAGTTTGAAAGGAATTGAAGGCTTCAGTAAACTAACTA
 
. : . : . : . : . : . :
rJMSF049P05+ TACATACTAAGAAGGCATGTTGAAAGGTATTCACAAATGATGCAGAGAATAGTTTCTATT
                      ____________________________________________________________
consensus TACATACTAAGAAGGCATGTTGAAAGGTATTCACAAATGATGCAGAGAATAGTTTCTATT
 
. : . : . : . : . : . :
rJMSF049P05+ TAATCTGGCCGTTCAGTTTCTCTAGCAAAGAAGGTTTATATAGAGTTTCAAGTCATTAAT
                      ____________________________________________________________
consensus TAATCTGGCCGTTCAGTTTCTCTAGCAAAGAAGGTTTATATAGAGTTTCAAGTCATTAAT
 
. : . : . : . : . : . :
rJMSF049P05+ GTCTGTTATTGAAGAATGGAAAGACAACAATCTGTATTGGGAGTATGAAAACCATCATAC
                      ____________________________________________________________
consensus GTCTGTTATTGAAGAATGGAAAGACAACAATCTGTATTGGGAGTATGAAAACCATCATAC
 
. : . : . : . : . : . :
rJMSF049P05+ TGTTTCAGCACTCTTGTCTTCATTATATTTAGCCTTTATTAAATTTAAATTTAAATTTAA
                      ____________________________________________________________
consensus TGTTTCAGCACTCTTGTCTTCATTATATTTAGCCTTTATTAAATTTAAATTTAAATTTAA
 
. : . : . : . : . : . :
rJMSF049P05+ ATTAAATTCTGATTCTGATTTGTAATAATATAGGACATGATGGTATTTGAATTAGATTAT
                      ____________________________________________________________
consensus ATTAAATTCTGATTCTGATTTGTAATAATATAGGACATGATGGTATTTGAATTAGATTAT