Previous Contig 013854:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025N18Sequence616007721 (3)pir|G96690|G966903e-54unknown protein F28G11.5 [imported] - Arabidopsis thaliana>gb:AE005173_894299 Ar670013854 (3)gb:AB022071_15149463e-33Brassica rapa mRNA for S-locus protein 3, partial cds.
JMSF046G07Sequence767007721 (3)pir|G96690|G966904e-77unknown protein F28G11.5 [imported] - Arabidopsis thaliana>gb:AE005173_894299 Ar805013854 (3)pir|G96690|G966903e-65unknown protein F28G11.5 [imported] - Arabidopsis thaliana>gb:AE005173_894299 Ar
JMSF049N22Sequence611007721 (3)pir|G96690|G966903e-62unknown protein F28G11.5 [imported] - Arabidopsis thaliana>gb:AE005173_894299 Ar691013854 (3)gb:AB022071_15149461e-33Brassica rapa mRNA for S-locus protein 3, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF046G07+ CACGACCTTACAA
                      ____________________________________________________________
consensus CACGACCTTACAA
 
. : . : . : . : . : . :
rJMSF046G07+ ACATGAACCTTGACAAGACACAGGTATTGGAGACCATTATAGCAAAGGAATATGGCGGAA
                      ____________________________________________________________
consensus ACATGAACCTTGACAAGACACAGGTATTGGAGACCATTATAGCAAAGGAATATGGCGGAA
 
. : . : . : . : . : . :
rJMSF046G07+ ATGAAAATTCCCTTCTGGGAGAATTGCCATTTTCCTTTATTGCATTTCTGATGGGACAGT
                      ____________________________________________________________
consensus ATGAAAATTCCCTTCTGGGAGAATTGCCATTTTCCTTTATTGCATTTCTGATGGGACAGT
 
. : . : . : . : . : . :
rJMSF046G07+ CACTTGAAGCATATTTACAGTGGAAGCTTATTGCCAGCCTTTTTCTTGGATGTACAGAGG
                      ____________________________________________________________
consensus CACTTGAAGCATATTTACAGTGGAAGCTTATTGCCAGCCTTTTTCTTGGATGTACAGAGG
 
. : . : . : . : . : . :
rJMSF046G07+ CTCCTCTTCACACAAGGAGTCAGCTATTCACCAAGTTTGTCCAAGTAATATATTATCAGT
rJMSF025N18+ TTTGTCCAAGTAATATATTATCAGT
rJMSF049N22+ TTGTCCAAGTAATATATTATCAGT
                      ____________________________________________________________
consensus CTCCTCTTCACACAAGGAGTCAGCTATTCACCAAGTTTGTCCAAGTAATATATTATCAGT
 
. : . : . : . : . : . :
rJMSF046G07+ TGAAATTTGGATTTCAAAAGGACGATAAAAATGCCGATGTTGCAGAGAAAGGAGCCATGG
rJMSF025N18+ TGAAATTTGGATTTCAAAAGGACGATAAAAATGCCGATGTTGCAGAGAAAGGAGCCATGG
rJMSF049N22+ TGAAATTTGGATTTCAAAAGGACGATAAAAATGCCGATGTTGCAGAGAAAGGAGCCATGG
                      ____________________________________________________________
consensus TGAAATTTGGATTTCAAAAGGACGATAAAAATGCCGATGTTGCAGAGAAAGGAGCCATGG
 
. : . : . : . : . : . :
rJMSF046G07+ CATTGTTGGATGAGTCTTGGTTATCTGATGACAGTTTCCTGCACATCCTTTGCAAGGACT
rJMSF025N18+ CATTGTTGGATGAGTCTTGGTTATCTGATGACAGTTTCCTGCACATCCTTTGCAAGGACT
rJMSF049N22+ CATTGTTGGATGAGTCTTGGTTATCTGATGACAGTTTCCTGCACATCCTTTGCAAGGACT
                      ____________________________________________________________
consensus CATTGTTGGATGAGTCTTGGTTATCTGATGACAGTTTCCTGCACATCCTTTGCAAGGACT
 
. : . : . : . : . : . :
rJMSF046G07+ TCTTCTCACTGCTACTTGAGGCCCCTGTGATTGATGGTGACCTCCTATCATGGACTAGAA
rJMSF025N18+ TCTTCTCACTGCTACTTGAGGCCCCTGTGATTGATGGTGACCTCCTATCATGGACTAGAA
rJMSF049N22+ TCTTCTCACTGCTACTTGAGGCCCCTGTGATTGATGGTGACCTCCTATCATGGACTAGAA
                      ____________________________________________________________
consensus TCTTCTCACTGCTACTTGAGGCCCCTGTGATTGATGGTGACCTCCTATCATGGACTAGAA
 
. : . : . : . : . : . :
rJMSF046G07+ AACTCAAAGATCTGCTCGAGGACTCTCTTGGTTGGGACTTTGAATCGAACAATGCAGCTG
rJMSF025N18+ AACTCAAAGATCTGCTCGAGGACTCTCTTGGTTGGGACTTTGAATCGAACAATGCAGCTG
rJMSF049N22+ AACTCAAAGATCTGCTCGAGGACTCTCTTGGTTGGGACTTTGAATCGAACAATGCAGCTG
                      ____________________________________________________________
consensus AACTCAAAGATCTGCTCGAGGACTCTCTTGGTTGGGACTTTGAATCGAACAATGCAGCTG
 
. : . : . : . : . : . :
rJMSF046G07+ ACGAATTAAATTTTGAAGATGATGAGTATGCTCCAGTGGTAGAGATGATAGATGAACCAG
rJMSF025N18+ ACGAATTAAATTTTGAAGATGATGAGTATGCTCCAGTGGTAGAGATGATAGATGAACCAG
rJMSF049N22+ ACGAATTAAATTTTGAAGATGATGAGTATGCTCCAGTGGTAGAGATGATAGATGAACCAG
                      ____________________________________________________________
consensus ACGAATTAAATTTTGAAGATGATGAGTATGCTCCAGTGGTAGAGATGATAGATGAACCAG
 
. : . : . : . : . : . :
rJMSF046G07+ GCCATAGCGGCATGGACACATCTTCAATCTAAACCCTAGCCAGAGGCAGACAATTATACC
rJMSF025N18+ GCCATAGCGGCATGGACACATCTTCAATCTAAACCCTAGCCAGAGGCAGACAATTATACC
rJMSF049N22+ GCCATAGCGGCATGGACACATCTTCAATCTAAACCCTAGCCAGAGGCAGACAATTATACC
                      ____________________________________________________________
consensus GCCATAGCGGCATGGACACATCTTCAATCTAAACCCTAGCCAGAGGCAGACAATTATACC
 
. : . : . : . : . : . :
rJMSF046G07+ GAGGGCAAACTCATTTTGCGGACCAACTAACGTCAGTGTGCTTTGTATATTACTGCAAAT
rJMSF025N18+ GAGGGCAAACTCATTTTGCGGACCAACTAACGTCAGTGTGCTTTGTATATTACTGCAAAT
rJMSF049N22+ GAGGGCAAACTCATTTTGCGGACCAACTAACGTCAGTGTGCTTTGTATATTACTGCAAAT
                      ____________________________________________________________
consensus GAGGGCAAACTCATTTTGCGGACCAACTAACGTCAGTGTGCTTTGTATATTACTGCAAAT
 
. : . : . : . : . : . :
rJMSF046G07+ AGTTGAAGGTATTACCATGATCAAATGGTGGAGTTTAATTTACAGGTCAGATATTGATAG
rJMSF025N18+ AGTTGAAGGTATTACCATGATCAAATGGTGGAGTTTAATTTACAGGTCAGATATTGATAG
rJMSF049N22+ AGTTGAAGGTATTACCATGATCAAATGGTGGAGTTTAATTTACAGGTCAGATATTGATAG
                      ____________________________________________________________
consensus AGTTGAAGGTATTACCATGATCAAATGGTGGAGTTTAATTTACAGGTCAGATATTGATAG
 
. : . : . : . : . : . :
rJMSF046G07+ AATTTTCTCACTGTAATATAATGTTGCCTAATCTACAGGAAAGCAACCTTTATGTGGCCC
rJMSF025N18+ AATTTTCTCACTGTAATATAATGTTGCCTAATCTACAGGAAAGCAACCTTTATGTGG-CC
rJMSF049N22+ AATTTTCTCACTGTAATATAATGTTGCCTAATCTACAGGAAAGCAACCTTTATGTGG-CC
                      ____________________________________________________________
consensus AATTTTCTCACTGTAATATAATGTTGCCTAATCTACAGGAAAGCAACCTTTATGTGG-CC
 
. : . : . : . : . : . :
rJMSF046G07+ TTGTTTTGGTTT
rJMSF025N18+ TTGTTTTGGTTTTGCTTACTTTGTTTTTGTGGTCCACTTCAATCCATACTTGTTACCATG
rJMSF049N22+ TTGTTTTGGTTTTGCTTACTTTGTTTTTGTGGTCCACTTCAATCCATACTTGTTA-CATG
                      ____________________________________________________________
consensus TTGTTTTGGTTTTGCTTACTTTGTTTTTGTGGTCCACTTCAATCCATACTTGTTACCATG
 
. : . : . : . : . : . :
rJMSF025N18+ TCACTGAAT
rJMSF049N22+ TCACTGAATTGAAGCTTTGATAGTTTGATTCTTATTTTTAGATTCTCAAATTCCTTGAGT
                      ____________________________________________________________
consensus TCACTGAATTGAAGCTTTGATAGTTTGATTCTTATTTTTAGATTCTCAAATTCCTTGAGT