Previous Contig 013845:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023J13Sequence268002992 (3)204013845 (3)gb:AB017065_15133792e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFC16.>gb:BT014856_1641
JMSF041H14Sequence351013845 (3)gb:AB017065_15133796e-24Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFC16.>gb:BT014856_1641
JMSF049K12Sequence597020496gb:AB017065_15133791e-81Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFC16.>gb:BT014856_1641690013845 (3)gb:AP003106_18247624e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P066

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF049K12+ GACAACAGCATCTGTGTATGACAAAGGCGG
                      ____________________________________________________________
consensus GACAACAGCATCTGTGTATGACAAAGGCGG
 
. : . : . : . : . : . :
rJMSF049K12+ AGGCCCCATACTGGCCCAGCGTGCGTATGCTAACCCCGACGTGAACCAATCTCCTGCAAC
                      ____________________________________________________________
consensus AGGCCCCATACTGGCCCAGCGTGCGTATGCTAACCCCGACGTGAACCAATCTCCTGCAAC
 
. : . : . : . : . : . :
rJMSF049K12+ ACCTTTTGATATGGGAAGTAGTNTCGTGAATGCAACTGCGGCATTGGATCCAGGGNNTAT
                      ____________________________________________________________
consensus ACCTTTTGATATGGGAAGTAGTNTCGTGAATGCAACTGCGGCATTGGATCCAGGGNNTAT
 
. : . : . : . : . : . :
rJMSF049K12+ TCTTGATTCAAGCTACAATGACTATATGTCATTTCTGTGTGGCATCAACGGATCCACCCC
                      ____________________________________________________________
consensus TCTTGATTCAAGCTACAATGACTATATGTCATTTCTGTGTGGCATCAACGGATCCACCCC
 
. : . : . : . : . : . :
rJMSF041H14+ GGCATGGACCT
rJMSF049K12+ TGTGGTTCTGAACTACACGAGCGAGAGCTGTGGCACCTCCACTTTGACTGGCATGGACCT
                      ____________________________________________________________
consensus TGTGGTTCTGAACTACACGAGCGAGAGCTGTGGCACCTCCACTTTGACTGGCATGGACCT
 
. : . : . : . : . : . :
rJMSF041H14+ CAACATGCCCTCGATCACAATTNCCAGGNTGANCCNATCCCGAGTGGTTCAACGAACCCT
rJMSF023J13+ GGTTCAACGAACCCT
rJMSF049K12+ CAACATGCCCTCGATCACAATTGCCAGGCTGAACCAATCCCGAGTGGTTCAACGAACCCT
                      ____________________________________________________________
consensus CAACATGCCCTCGATCACAATTGCCAGGCTGAACCAATCCCGAGTGGTTCAACGAACCCT
 
. : . : . : . : . : . :
rJMSF041H14+ GACTAACGTGGGNGGCAGCGAATCATATGTNGTTGGGTGGAGTNCGCCNTACGGGGCTTC
rJMSF023J13+ GACNAATGNGGGTGGCAGNGAATCNTATGTTGTTGGNTGGAGTGCGCCTTNCGGGGTTTC
rJMSF049K12+ GACTAATGTGGGTGGCAGCGAATCATATGTTGTTGGGTGGAGTGCGCCTTACGGGGCTTC
                      ____________________________________________________________
consensus GACTAATGTGGGTGGCAGCGAATCATATGTTGTTGGGTGGAGTGCGCCTTACGGGGCTTC
 
. : . : . : . : . : . :
rJMSF041H14+ GGNGAAGNTAACGCCAACGCGGTTTTGTGTAGGAAGCGGGGAGAGNTTGAACTTGNTCAT
rJMSF023J13+ GGNGAAGGTAANGCCAACGCGGTTTTGTGTNGGAAGCGGGGAGAGTTTGAACTTGNCCAT
rJMSF049K12+ GGTGAAGGTAACGCCAACGCGGTTTTGTGTAGGAAGCGGGGAGAGTTTGAACTTGACCAT
                      ____________________________________________________________
consensus GGTGAAGGTAACGCCAACGCGGTTTTGTGTAGGAAGCGGGGAGAGTTTGAACTTGACCAT
 
. : . : . : . : . : . :
rJMSF041H14+ ATCGTTTAACGNGACTATGAACAACAGCANCCCGAGTTTTGGAAGGATCGGGTTGTTNCG
rJMSF023J13+ NTCGTTNAACGTGANTATGAACAACAGCAGCCCGAGTTNNGGAAGNATCNGGTTGTT
rJMSF049K12+ ATCGTTTAACGCGACTATGAACAACAGCAGCCCGAGTTTTGGAAGGATCGGGTTGTTTGG
                      ____________________________________________________________
consensus ATCGTTTAACGTGACTATGAACAACAGCAGCCCGAGTTTTGGAAGGATCGGGTTGTTTGG
 
. : . : . : . : . : . :
rJMSF041H14+ AAACCANGGCCATGTTGTAAACATTCCTTTGTCTGTCATTGNCAAAATTTCGTATAACAC
rJMSF049K12+ AAACCATGGCCATGTTGTAAACATTCCTTTGTCTGTCATTGTCAAAATTTCGTATAACAC
                      ____________________________________________________________
consensus AAACCATGGCCATGTTGTAAACATTCCTTTGTCTGTCATTGTCAAAATTTCGTATAACAC
 
. : . : . : . : . : . :
rJMSF041H14+ AA
rJMSF049K12+ AAGCTAGTGCTTGATTGATACTTCTTCTCATCTTGTTATTTTGTATTTTTTGTATGCCCA
                      ____________________________________________________________
consensus AAGCTAGTGCTTGATTGATACTTCTTCTCATCTTGTTATTTTGTATTTTTTGTATGCCCA
 
. : . : . : . : . : . :
rJMSF049K12+ AATTTTTTGAGTTATTAGCTCTGTAAAGATGTGTCCAAATGTAGATATAACTTTACTGCC
                      ____________________________________________________________
consensus AATTTTTTGAGTTATTAGCTCTGTAAAGATGTGTCCAAATGTAGATATAACTTTACTGCC