Previous Contig 013844:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011L17Sequence242013844 (12)sp|O04267|SARB_BRACM0.005GTP-binding protein SAR1B.>gb:BCU55036_1632825 Brassica campestris small GTP-bin638013844 (12)pir|T52096|T520962e-58small GTP-binding protein Sar1BNt [imported] - common tobacco>gb:AF210431_177734
JMFF015K09Sequence609013844 (12)pir|T16966|T169665e-60GTP-binding protein (clone Np50SAR) - curled-leaved tobacco>gb:NP50SAR_1691040 N699013844 (12)pir|T52096|T520968e-70small GTP-binding protein Sar1BNt [imported] - common tobacco>gb:AF210431_177734
JMFF032I22Sequence557002050 (2)pir|T16966|T169662e-51GTP-binding protein (clone Np50SAR) - curled-leaved tobacco>gb:NP50SAR_1691040 N694013844 (12)pir|T52096|T520969e-76small GTP-binding protein Sar1BNt [imported] - common tobacco>gb:AF210431_177734
JMFF048B16Sequence440002050 (2)gb:AY620417_16183392e-25Oryza sativa (japonica cultivar-group) clone P0705D01 GTP-binding protein (GBP) 314013844 (12)sp|P52884|SAR2_LYCES2e-07GTP-binding protein SAR2.>pir|S42528|S42528 GTP-binding protein SAR1 homolog - t
JMSF028C05Sequence700013844 (12)pir|T52096|T520966e-75small GTP-binding protein Sar1BNt [imported] - common tobacco>gb:AF210431_177734726013844 (12)pir|T52096|T520963e-85small GTP-binding protein Sar1BNt [imported] - common tobacco>gb:AF210431_177734
JMSF031I09Sequence617013844 (12)pir|T16966|T169662e-59GTP-binding protein (clone Np50SAR) - curled-leaved tobacco>gb:NP50SAR_1691040 N667013844 (12)pir|T52096|T520962e-76small GTP-binding protein Sar1BNt [imported] - common tobacco>gb:AF210431_177734
JMSF049K09Sequence675013844 (12)pir|T52096|T520962e-76small GTP-binding protein Sar1BNt [imported] - common tobacco>gb:AF210431_177734728013844 (12)pir|T52096|T520969e-50small GTP-binding protein Sar1BNt [imported] - common tobacco>gb:AF210431_177734

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF011L17- GTGGAAGCTGGAAGCATTTGTAAACGGCGATGAACCAAACGCACACCTACG
JMFF015K09- GGTGGAAGCTGGAAGCATTTGTAAACGGCGATGAACCAAACGCACACCTACG
JMSF049K09- AAACGGCGATGAACCAAACGCACACCTACG
                      ____________________________________________________________
consensus GGTGGAAGCTGGAAGCATTTGTAAACGGCGATGAACCAAACGCACACCTACG
 
. : . : . : . : . : . :
JMFF011L17- CATTGCTCCNAAATGCGTTAGCGTTTTGAGGAGTTCTCTGTTGAATCAATCGAAAGGGAT
JMFF015K09- CATTGCTCCAAAATGCGTTAGCGTTTTGAGGAGTTCTCTGTTGAATCAATCGAAAGGGAT
JMSF049K09- CATTGCTCCAAAATGCGTTAGCGTTTTGAGGAGTTCTCTGTTGAATCAATCGAAAGGGAT
                      ____________________________________________________________
consensus CATTGCTCCAAAATGCGTTAGCGTTTTGAGGAGTTCTCTGTTGAATCAATCGAAAGGGAT
 
. : . : . : . : . : . :
JMSF031I09- AGAGGGTTGTCTGCAATCTGGTAGTATTAATTTAATTCACCTCATA
JMFF011L17- TGCGAAATCAAC----AGGGTTGTCTGCAATCTGGTANTATTAATTTAATTCACCTCATA
JMFF015K09- TGCGAAATCAACGTAGAGGGTTGTCTGCAATCTGGTAGTATTAATTTAATTCACCTCATA
JMSF028C05- AGAGGGTTGTCTGCAATCTGGTAGTATTAATTTAATTCACCTCATA
JMSF049K09- TGCGAAATCAACGTAGAGGGTTGTCTGCAATCTGGTAGTATTAATTTAATTCACCTCATA
                      ____________________________________________________________
consensus TGCGAAATCAACGTAGAGGGTTGTCTGCAATCTGGTAGTATTAATTTAATTCACCTCATA
 
. : . : . : . : . : . :
JMSF031I09- TATCAACGTATACACGGAAGGATGTTCTTGGTCGATTGGTTCTACGGGATTCTCGCATCG
JMFF011L17- TATCAACGTATACACGGAAGGATGTTCTTGGNCGATTGGTTCTACGGGATTCTCGCATCG
JMFF015K09- TATCAACGTATACACGGAAGGATGTTCTTGGTCGATTGGTTCTACGGGATTCTCGCATCG
JMSF028C05- TATCAACGTATACACGGAAGGATGTTCTTGGTCGATTGGTTCTACGGGATTCTCGCATCG
JMSF049K09- TATCAACGTATACACGGAAGGATGTTCTTGGTCGATTGGTTCTACGGGATTCTCGCATCG
rJMSF028C05+ TCTCGCATCG
                      ____________________________________________________________
consensus TATCAACGTATACACGGAAGGATGTTCTTGGTCGATTGGTTCTACGGGATTCTCGCATCG
 
. : . : . : . : . : . :
JMSF031I09- CTGGGCCTGTGGCAGAAGGAGGCTAAAATCTTGTTCTTGGGCCTCGATAATGCTGGCAAA
JMFF011L17- CTGGGCCTGTGGCAG
JMFF015K09- CTGGGCCTGTGGCAGAAGGAGGCTAAAATCTTGTTCTTGGGCCTCGATAATGCTGGCAAA
JMSF028C05- CTGGGCCTGTGGCAGAAGGAGGCTAAAATCTTGTTCTTGGGCCTCGATAATGCTGGCAAA
JMSF049K09- CTGGGCCTGTGGCAGAAGGAGGCTAAAATCTTGTTCTTGGGCCTCGATAATGCTGGCAAA
rJMSF031I09+ TCTTGGGCCTCGATAATGCTGGCAAA
rJMSF028C05+ CTGGGCCTGTGGCAGAAGGAGGCTAAAATCTTGTTCTTGGGCCTCGATAATGCTGGCAAA
rJMFF015K09+ ATGCTGGCAAA
rJMFF032I22+ GGGCCTCGATAATGCTGGCAAA
                      ____________________________________________________________
consensus CTGGGCCTGTGGCAGAAGGAGGCTAAAATCTTGTTCTTGGGCCTCGATAATGCTGGCAAA
 
. : . : . : . : . : . :
JMSF031I09- ACGGCCTTGC-TTCACATGTTGAAAGATGAGAGATTAGTCCAACATCAGCCTACACAGTA
JMFF015K09- ACGACCTTGC-TTCACATGTTGAAAGATGAGAGATTAGTCCAACATCAGCCTACACAGTA
JMSF028C05- ACGACCTTGC-TTCACATGTTGAAAGATGAGAGATTAGTCCAACATCAGCCTACACAGTA
JMSF049K09- ACGACCTTGC-TTCACATGTTGAAAGATGAGAGATTAGTCCAACATCAGCCTACACAGTA
rJMSF031I09+ ACGGCCTTGC-TTCACATGTTGAAAGATGAGAGATTAGTCCAACATCAGCCTACACAGTA
rJMSF028C05+ ACGACCTTGC-TTCACATGTTGAAAGATGAGAGATTAGTCCAACATCAGCCTACACAGTA
rJMFF011L17+ CATGTTGAAAGATGAGAGATTAGTCCAACATCAGCCTACACAGTA
rJMFF015K09+ ACGACCTTGCTTTCACATGTTGAAAGATGAGAGATTAGTCCAACATCAGCCTACACAGTA
rJMFF032I22+ ACGACCTTGC-TTCACATGTTGAAAGATGAGAGATTAGTCCAACATCAGCCTACACAGTA
                      ____________________________________________________________
consensus ACGACCTTGC-TTCACATGTTGAAAGATGAGAGATTAGTCCAACATCAGCCTACACAGTA
 
. : . : . : . : . : . :
JMSF031I09- CCCAACATCTGAGGAGCTGAGTATTGGGAAAATCAAGTTTAAGGCTTTTGACTTGGGAGG
JMFF015K09- CCCAACATCTGAGGAGCTGAGTATTGGGAAAATCAAGTTTAAGGCTTTTGACTTGGGAGG
JMSF028C05- CCCAACATCTGAGGAGCTGAGTATTGGGAAAATCAAGTTTAAGGCTTTTGACTTGGGAGG
JMSF049K09- CCCAACATCTGAGGAGCTGAGTATTGGGAAAATCAAGTTTAAGGCTTTTGACTTGGGAGG
rJMSF031I09+ CCCAACATCTGAGGAGCTGAGTATTGGGAAAATCAAGTTTAAGGCTTTTGACTTGGGAGG
rJMSF028C05+ CCCAACATCTGAGGAGCTGAGTATTGGGAAAATCAAGTTTAAGGCTTTTGACTTGGGAGG
rJMFF011L17+ CCCAACATTTGAGGAGCTGAGTATTGGGAAAATCAAGTTTAAGGCTTTTGACTTGGGAGG
rJMFF015K09+ CCCAACATNTGAGGAGCTGAGTATTGGGAAAATCAAGTTTAAGGCTTTTGACTTGGGAGG
rJMFF032I22+ CCCAACATTTGAGGAGCTGAGTATTGGGAAAATCAAGTTTAAGGCTTTTGACTTGGGAGG
                      ____________________________________________________________
consensus CCCAACATCTGAGGAGCTGAGTATTGGGAAAATCAAGTTTAAGGCTTTTGACTTGGGAGG
 
. : . : . : . : . : . :
JMSF031I09- GCATCAAATTGCCCGCCGCGTTTGGAAGGACTATTATGCTAAGGTGGATGCTGTTGTTTA
JMFF015K09- GCATCAAATTGCCCGCCGCGTTTGGAAGGACTATTATGCTAAGGTGGATGCTGTTGTTTA
JMSF028C05- GCATCAAATTGCCCGCCGCGTTTGGAAGGACTATTATGCTAAGGTGGATGCTGTTGTTTA
JMSF049K09- GCATCAAATTGCCCGCCGCGTTTGGAAGGACTATTATGCTAAGGTGGATGCTGTTGTTTA
rJMSF031I09+ GCATCAAATTGCCCGCCGCGTTTGGAAGGACTATTATGCTAAGGTGGATGCTGTTGTTTA
rJMSF028C05+ GCATCAAATTGCCCGCCGCGTTTGGAAGGACTATTATGCTAAGGTGGATGCTGTTGTTTA
rJMFF011L17+ GCATCAAATTGCCCGCCGCGTTTGGAAGGACTATTATGTTAAGGTGGATGCTGTTGTTTA
rJMFF015K09+ GCATCAAATTGCCCGCCGCGTTTGGAAGGACTATTATGCTAAGGTGGATGCTGTTGTTTA
rJMFF032I22+ GCATCAAATTGCCCGCCGCGTTTGGAAGGACTATTATGCTAAGGTGGATGCTGTTGTTTA
rJMSF049K09+ GTTGTTTA
                      ____________________________________________________________
consensus GCATCAAATTGCCCGCCGCGTTTGGAAGGACTATTATGCTAAGGTGGATGCTGTTGTTTA
 
. : . : . : . : . : . :
JMSF031I09- CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGCTGGATGCTCT
JMFF015K09- CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGCTGGATGCTCT
JMSF028C05- CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGCTGGATGCTCT
JMSF049K09- CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGCTGGATGCTCT
rJMSF031I09+ CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGCTGGATGCTCT
rJMSF028C05+ CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGCTGGATGCTCT
rJMFF011L17+ CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGNTGGATGCTCT
rJMFF015K09+ CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGCTGGATGCTCT
rJMFF032I22+ CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGCTGGATGCTCT
rJMSF049K09+ CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGCTGGATGCTCT
                      ____________________________________________________________
consensus CTTGGTGGATGCCTACGATAAAGAAAGATTTGCGGAGTCAAAGAAAGAGCTGGATGCTCT
 
. : . : . : . : . : . :
JMSF031I09- CCTGTCAGATGAGTCTTTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
JMFF015K09- CCTGTCAGATGAGTCTTTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
JMSF028C05- CCTGTCAGATGAGTCTTTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
JMSF049K09- CCTGTCAGATGAGTCTTTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
rJMSF031I09+ CCTGTCAGATGAGTCTTTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
rJMSF028C05+ CCTGTCAGATGAGTCTTTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
rJMFF011L17+ CCNGTCAGATGAGTCTNTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
rJMFF015K09+ CCTGTCAGATGAGTCTTTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
rJMFF032I22+ CCTGTCAGATGAGTCTTTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
rJMSF049K09+ CCTGTCAGATGAGTCTTTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
                      ____________________________________________________________
consensus CCTGTCAGATGAGTCTTTGGCTAATGTACCGTTTCTAATTTTGGGTAACAAGATTGACAT
 
. : . : . : . : . : . :
JMSF031I09- CCCATATGCTGCCTCAG
JMFF015K09- CCCATATGCTGCCTCAGA
JMSF028C05- CCCATATGCTGCCTCAGAAGATGAATTGCAATACCACATGGGGCTGACTGGCATCACCAC
JMSF049K09- CCCATATGCTGCCTCAGAAGATGAATTGCAATACCACATGGGGCTGACTGGCATCACCAC
rJMSF031I09+ CCCATATGCTGCCTCAGAAGATGAATTGCAATACCACATGGGGCTGACTGGCATCACCAC
rJMSF028C05+ CCCATATGCTGCCTCAGAAGATGAATTGCAATACCACATGGGGCTGACTGGCATCACCAC
rJMFF011L17+ CCCATATGCTGCCTCAGAAGATGAATTGCAATNCCACATGGGGNTGACTGGCATCACCAC
rJMFF015K09+ CCCATATGCTGCCTCAGAAGATGAATTGCAATACCACATGGGGCTGACTGGCATCACCAC
rJMFF032I22+ CCCATATGCTGCCTCAGAAGATGAATTGCAATACCACATGGGGCTGACTGGCATCACCAC
rJMSF049K09+ CCCATATGCTGCCTCAGAAGATGAATTGCAATACCACATGGGGCTGACTGGCATCACCAC
                      ____________________________________________________________
consensus CCCATATGCTGCCTCAGAAGATGAATTGCAATACCACATGGGGCTGACTGGCATCACCAC
 
. : . : . : . : . : . :
JMSF028C05- TGGCAAGGGAAAGGTAAACCTGGCAGACACTAATGTTC
JMSF049K09- TGGCAAGGGAAAGGTAAACCTGGCAGACACTAATGTTCGCCCA
rJMSF031I09+ TGGCAAGGGAAAGGTAAACCTGGCAGACACTAATGTTCGCCCACTTGAGGTATTCATGTG
rJMSF028C05+ TGGCAAGGGAAAGGTAAACCTGGCAGACACTAATGTTCGCCCACTTGAGGTATTCATGTG
rJMFF011L17+ TGGCAAGGGAAAGGTAAACCTGGCAGACACTAATGTTCGCCCACTTGAGGTATTCATGTG
rJMFF015K09+ TGGCAAGGGAAAGGTAAACCTGGCAGACACTAATGTTCGCCCACTTGAGGTATTCATGTG
rJMFF032I22+ TGGCAAGGGAAAGGTAAACCTGGCAGACACTAATGTTCGCCCACTTGAGGTGTTCATGTG
rJMFF048B16+ GGTATTCATGTG
rJMSF049K09+ TGGCAAGGGAAAGGTAAACCTGGCAGACACTAATGTTCGCCCNCTTGAGGTATTCATGTG
                      ____________________________________________________________
consensus TGGCAAGGGAAAGGTAAACCTGGCAGACACTAATGTTCGCCCACTTGAGGTATTCATGTG
 
. : . : . : . : . : . :
rJMSF031I09+ CAGCATAGTCCGCAAAATGGGTTATGGAGAAGGCTTCAAATGGATGTCTCAATACATCAA
rJMSF028C05+ CAGCATAGTCCGCAAAATGGGTTATGGAGAAGGCTTCAAATGGATGTCTCAATACATCAA
rJMFF011L17+ CAGCATAGTCCGCAAAATGGGTTATGGAGAAGGCTTCAAATGGATGTCTCAATACATCAA
rJMFF015K09+ CAGCATAGTCCGCAAAATGGGTTATGGAGAAGGCTTCAAATGGATGTCTCAATACATCAA
rJMFF032I22+ CAGCATAGTCCGCAAAATGGGTTATGGAGAAGGCTTCAAATGGATGTCTCAATACATCAA
rJMFF048B16+ CAGCATAGTCCGCAAAATGGGTTATGGAGAAGGCTTCAAATGGATGTCTCAATACATCAA
rJMSF049K09+ CAGCATAGTCCGCAAAATGGGTTATGGAGAAGGCTTCAAATGGATGTCTCAATACATCAA
                      ____________________________________________________________
consensus CAGCATAGTCCGCAAAATGGGTTATGGAGAAGGCTTCAAATGGATGTCTCAATACATCAA
 
. : . : . : . : . : . :
rJMSF031I09+ GTAGATCCATTTCCAAAAAAAAAGTAGATGCAAGTGTTATTTCGTACTCTAGGGCTCTAG
rJMSF028C05+ GTAGATCCATTTCC-AAAAAAAAGTAGATGCAAGTGTTATTTCGTACTCTAGGGCTCTAG
rJMFF011L17+ GTAGATCCATTTCCAAAAAAAAAGTAGATGCAAGTGTTATTTCGTACTCTAGGGCTCTAG
rJMFF015K09+ GTA
rJMFF032I22+ GTAGATCCATTTCCAAAAAAAAAGTAGATGCAAGTGTTATTTCGTACTCTAGGGCTCTAG
rJMFF048B16+ GTAGATCCATTTCCAAAAAAAAAGTAGATGCAAGTGTTATTTCGTACTCTAGGGCTCTAG
rJMSF049K09+ GTAGATCCATTTCCAAAAAAAAAGTAGATGCAAGTGTTATTTCGTACTCTAGGGCTCTAG
                      ____________________________________________________________
consensus GTAGATCCATTTCCAAAAAAAAAGTAGATGCAAGTGTTATTTCGTACTCTAGGGCTCTAG
 
. : . : . : . : . : . :
rJMSF031I09+ GCAAAGAGTGTTTGCCCTTGTGAAAAGTGGTGGTTGAATATATGTCGCCATTGATTTCAG
rJMSF028C05+ GCAAAGAGTGTTTGCCCTTGTGAAAAGTGGTGGTTGAATATATGTCGCCATTGATTTCAG
rJMFF011L17+ GCAAAGAGTGTTTGCCCTTGTGAAAAGTGGTGGTTGAATATATGTCGCCATTGATTTCAG
rJMFF032I22+ GCAAAGAGTGTTTGCCCTTGTGAAAAGTGGTGGTTGAATATATGTCGCCATTGATTTCAG
rJMFF048B16+ GCAAAGAGTGTTTGCCCTTGTGAAAAGTGGTGGTTGAATATATGTCGCCATTGATTTCAG
rJMSF049K09+ GCAAAGAGTGTTTGCCCTTGTGAAAAGTGGTGGTTGAATATATGTCGCCATTGATTTCAG
                      ____________________________________________________________
consensus GCAAAGAGTGTTTGCCCTTGTGAAAAGTGGTGGTTGAATATATGTCGCCATTGATTTCAG
 
. : . : . : . : . : . :
rJMSF031I09+ TTTTTGGTGAAATGACAAAGAACCATTTCTGTTACATCATCA
rJMSF028C05+ TTTTTGGTGAAATGACAAAGAACCATTTCTGTTACATCATCACCTCTCAAATTTGAGA
rJMFF011L17+ TTTTTGGTGAAATGACAAAGAACCATTTCTGTTACATCATCACCTCTCAAATT
rJMFF032I22+ TTTTTGGTGAAATGACAAAGAACCATTTCTGTTACATCATCACCTCTCAAATTTGAGATG
rJMFF048B16+ TTTTTGGTGAAATGACAAAGAACCATTTTTGTTACATCATCACCTCTCAAATTTGAGATG
rJMSF049K09+ TTTTTGGTGAAATGACAAAGAACCATTTCTGTTACATCATCACCTCTCAAATTTGAGATG
                      ____________________________________________________________
consensus TTTTTGGTGAAATGACAAAGAACCATTTCTGTTACATCATCACCTCTCAAATTTGAGATG
 
. : . : . : . : . : . :
rJMFF032I22+ GAACATATATTTA
rJMFF048B16+ GAACATATATTTAGTTCTTTAATGCCATTTCCTTCTTTAGACCTCA
rJMSF049K09+ GAACATATATTTAGTTCTTTAATGCCATTTCCTTCTTTAGACCTCAGCTAATATATTCAG
                      ____________________________________________________________
consensus GAACATATATTTAGTTCTTTAATGCCATTTCCTTCTTTAGACCTCAGCTAATATATTCAG
 
. : . : . : . : . : . :
rJMSF049K09+ ACATATATTCTCAAGTTTAGGTGTGTATTTGACACTTTTTTTTTCAGTTACCAGAGCCCA
                      ____________________________________________________________
consensus ACATATATTCTCAAGTTTAGGTGTGTATTTGACACTTTTTTTTTCAGTTACCAGAGCCCA
 
. : . : . : . : . : . :
rJMSF049K09+ AGTACTGTGTTTGAAATAGTTATATGGCCCATGTAGTTGCAGGTATTAAAGTATGCTCCA
                      ____________________________________________________________
consensus AGTACTGTGTTTGAAATAGTTATATGGCCCATGTAGTTGCAGGTATTAAAGTATGCTCCA
 
. : . : . : . : . : . :
rJMSF049K09+ CTCATCAAATAAGAGTTTCAAGAATGAAGATCAGAAGTCAATTGACAATTGTATAAGATT
                      ____________________________________________________________
consensus CTCATCAAATAAGAGTTTCAAGAATGAAGATCAGAAGTCAATTGACAATTGTATAAGATT