Previous Contig 013842:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF008B14Sequence252004947 (2)784013842 (2)gb:ATH555407_15528861e-68Arabidopsis thaliana partial mRNA for SOL1 protein, splice variant A1B1-L.>gb:AT
JMSF049J24Sequence659004947 (2)pir|B96739|B967395e-46hypothetical protein F14O23.7 [imported] - Arabidopsis thaliana>gb:AE005173_8947773013842 (2)gb:ATH555407_15528862e-71Arabidopsis thaliana partial mRNA for SOL1 protein, splice variant A1B1-L.>gb:AT

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008B14+ AGATNAAAAGGAAT
                      ____________________________________________________________
consensus AGATNAAAAGGAAT
 
. : . : . : . : . : . :
rJMSF008B14+ ATTACTTTGCNTGCCCTGATGATGGAACTTTCAGATATATGGGAAAGTTTATATAGTCAT
rJMSF049J24+ TTGCNTGCCCTGATGATGAAACTTTCAGATATATGGG-AAGTTTATATAGTCAT
                      ____________________________________________________________
consensus ATTACTTTGCNTGCCCTGATGATGGAACTTTCAGATATATGGGAAAGTTTATATAGTCAT
 
. : . : . : . : . : . :
rJMSF008B14+ CATCACCGTAACATGTCTTTAAGCACGGAATTTGCAGAAGGAATTACAAATGGTGCACAT
rJMSF049J24+ CATCACCGTAACATGTCTCTAAGCACGGAATTTGCAGAAGGAATTACAAATGGTGCACAT
                      ____________________________________________________________
consensus CATCACCGTAACATGTCTTTAAGCACGGAATTTGCAGAAGGAATTACAAATGGTGCACAT
 
. : . : . : . : . : . :
rJMSF008B14+ TGGTACCCTATTTATGGCGGCATGCAAGATTGGAATTACATAAATGCCGGCTGTTTTGAG
rJMSF049J24+ TGGTACCCTATTTATGGCGGCATGCAAGATTGGAATTACATAAATGCCGGCTGTTTTGAG
                      ____________________________________________________________
consensus TGGTACCCTATTTATGGCGGCATGCAAGATTGGAATTACATAAATGCCGGCTGTTTTGAG
 
. : . : . : . : . : . :
rJMSF008B14+ TTAACATTAGAGATTAGTGATGATAAATGGCCTAATGCAACTGAACTTCCCACTCTTTGG
rJMSF049J24+ TTAACATTAGAGATTAGTGATGATAAATGGCCTAATGCAACTGAACTTCCCACTCTTTGG
                      ____________________________________________________________
consensus TTAACATTAGAGATTAGTGATGATAAATGGCCTAATGCAACTGAACTTCCCACTCTTTGG
 
. : . : . : . : . : . :
rJMSF008B14+ GAATACAACAAAATGAGTATGCTACATCTTGTTGCAAGTGTTGTAAAGGCCGGAATTCAT
rJMSF049J24+ GAATACAACAAAATGAGTATGCTACATCTTGTTGCAAGTGTTGTAAAGGCCGGAATTCAT
                      ____________________________________________________________
consensus GAATACAACAAAATGAGTATGCTACATCTTGTTGCAAGTGTTGTAAAGGCCGGAATTCAT
 
. : . : . : . : . : . :
rJMSF008B14+ GGAAAGATCTTTTCTTCTGATCATGGAAAGCCTTTACCCGCTTCAATAGACATAAAGGGA
rJMSF049J24+ GGAAAGATCTTTTCTTCTGATCATGGAAAGCCTTTACCCGCTTCAATAGACATAAAGGGA
                      ____________________________________________________________
consensus GGAAAGATCTTTTCTTCTGATCATGGAAAGCCTTTACCCGCTTCAATAGACATAAAGGGA
 
. : . : . : . : . : . :
rJMSF008B14+ ATAAATTACACGATAAAAGCTGGCGAAACATTTGCAGACTACCACCGCCTATTAGCTCCT
rJMSF049J24+ ATAAATTACACGATAAAAGCTGGCGAAACATTTGCAGACTACCACCGCCTATTAGCTCCT
                      ____________________________________________________________
consensus ATAAATTACACGATAAAAGCTGGCGAAACATTTGCAGACTACCACCGCCTATTAGCTCCT
 
. : . : . : . : . : . :
rJMSF008B14+ GGCAACAATTATGAAGTTGTGGCAACGATGCCGGGATACAAGTCAAAGAGCACTCACATC
rJMSF049J24+ GGCAACAATTATGAAGTTGTGGCAACGATGCCGGGATACAAGTCAAAGAGCACTCACATC
                      ____________________________________________________________
consensus GGCAACAATTATGAAGTTGTGGCAACGATGCCGGGATACAAGTCAAAGAGCACTCACATC
 
. : . : . : . : . : . :
rJMSF008B14+ ATTTTGGGGGAAGAAGCCATGACAGTGGACTTTATTCTTGATCCGGTAATCGCTAATGCA
rJMSF049J24+ ATTTTGGGGGAAGAAGCCATGACAGTGGACTTTATTCTTGATCCGGTAATCGCTAATGCA
                      ____________________________________________________________
consensus ATTTTGGGGGAAGAAGCCATGACAGTGGACTTTATTCTTGATCCGGTAATCGCTAATGCA
 
. : . : . : . : . : . :
rJMSF008B14+ GATGATGGCTCCTTGCAGAAGAGCTGGGATAACAACTTCTTGCCATGGTGGCAGTCGAAA
rJMSF049J24+ GATGATGGCTCCTTGCAGAAGAGCTGGGATAACAACTTCTTGCCATGGTGGCAGTCGAAA
                      ____________________________________________________________
consensus GATGATGGCTCCTTGCAGAAGAGCTGGGATAACAACTTCTTGCCATGGTGGCAGTCGAAA
 
. : . : . : . : . : . :
rJMSF008B14+ CTTTTTATTATTTTGATTCTAATATTGACTTTCCTTTGCATCTTATTGAGGAGTAGATTA
rJMSF049J24+ CTTTTTATTATTTTGATTCTAATATTGACTTTCCTTTGCATCTTATTGAGGAGTAGATTA
                      ____________________________________________________________
consensus CTTTTTATTATTTTGATTCTAATATTGACTTTCCTTTGCATCTTATTGAGGAGTAGATTA
 
. : . : . : . : . : . :
rJMSF008B14+ TTAAACCGGTCCAAACATAGACAGAATGCAGGGTTAAAAAGGCCTCAATTATAAGGTTTT
rJMSF049J24+ TTAAACCGGTCCAAACATAGACAGAATGCAGGGTTAAAAAGGCCTCAATTATAAGGTTTT
                      ____________________________________________________________
consensus TTAAACCGGTCCAAACATAGACAGAATGCAGGGTTAAAAAGGCCTCAATTATAAGGTTTT
 
. : . : . : . : . : . :
rJMSF008B14+ TGAGTTTGCCTTCCTCAAGAGAATCTGTACCTTATAATGTAAAATTTTTA
rJMSF049J24+ TGAGTTTGCCTTCCTCAAGAGAATCTGTACCTTATAATGTAAAATTTTTATATTACAATA
                      ____________________________________________________________
consensus TGAGTTTGCCTTCCTCAAGAGAATCTGTACCTTATAATGTAAAATTTTTATATTACAATA